Add setc.tsv input file

uio-bmi · Oct 27, 2021 · 451ac39 · 451ac39
1 parent 1b211e9
commit 451ac39
Showing 1 changed file with 3 additions and 0 deletions.
diff --git a/test/setc.tsv b/test/setc.tsv
@@ -0,0 +1,3 @@
+repertoire_id	sequence_id	duplicate_count	v_call	j_call	junction	junction_aa	sequence	rev_comp	productive	d_call	sequence_alignment	germline_alignment	v_cigar	d_cigar	j_cigar
+C	X	1	TCRBV07-09	TCRBJ01-02	tgcgcgagcagcctgcgcgtgggcggctttggctataccttt	CASSLRVGGFGYTF									
+C	Y	1	TCRBV07-06	TCRBJ02-01	tgcgcgagcagcaccagccatcagcagtatttt	CASSTSHQQYF