-
Notifications
You must be signed in to change notification settings - Fork 484
Add tool to detect circular sequences #7296
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
base: main
Are you sure you want to change the base?
Changes from 2 commits
File filter
Filter by extension
Conversations
Jump to
Diff view
Diff view
There are no files selected for viewing
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| CitationsMissing |
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,15 @@ | ||
| name: detect_circular_sequences | ||
| description: Detect circular sequences (e.g. circular contigs) in a FASTA file by k-mer matching | ||
| long_description: | | ||
| Detect circular sequences (e.g. circular contigs) by looking for exact identical k-mer at the two | ||
| ends on a cadre sequence of the sequences prodvide in fasta file. In order to be able | ||
| to predict genes spanning the origin of circular sequences, the first 1,000 nucleotides | ||
| of each circular sequences are duplicated and added at the sequence's end. | ||
|
|
||
| Inspired by Simon Roux work for Metavir2 (2014) and Corentin Hochart work in PlasSuite | ||
| categories: | ||
| - Sequence Analysis | ||
| - Assembly | ||
| remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/detect_circular_sequences | ||
| homepage_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/detect_circular_sequences | ||
| type: unrestricted | ||
|
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. Can you publish this python script separately (extra git repo + bioconda recipe) or re-use existing implementations? I think we should limit publishing software via IUC (except maybe for trivial cases) and restrict to Galaxy tools. IUC seems already busy with the tool wrappers and I'm afraid of the additional workload caused by scripts. |
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,286 @@ | ||
| #!/usr/bin/env python3 | ||
|
|
||
| ######################################################################################### | ||
| # This script detect circular contigs by looking for exact identical k-mer at the two | ||
| # ends on a cadre sequence of the sequences prodvide in fasta file. In order to be able | ||
| # to predict genes spanning the orgin of circular contigs, the first 1,000 nucleotides | ||
| # of each circular contigs are dulicated and added at the contig's end. | ||
| # | ||
| # Inspired by Simon Roux work for Metavir2 (2014) and Corentin Hochart work in PlasSuite | ||
| # | ||
| ######################################################################################### | ||
|
|
||
| import argparse | ||
| import re | ||
| import sys | ||
| import tempfile | ||
| import textwrap | ||
| from pathlib import Path | ||
|
|
||
|
|
||
| def error(message): | ||
| """ | ||
| Print an error message to stderr and exit the program with a non-zero status. | ||
|
|
||
| Args: | ||
| message (str): The error message to display. | ||
| """ | ||
| print(f"{sys.argv[0]} (error): {message}. Execution halted.", file=sys.stderr) | ||
| sys.exit(1) | ||
|
|
||
|
|
||
| def warning(message, verbose): | ||
| """ | ||
| Print a warning message to stderr if verbose mode is enabled. | ||
|
|
||
| Args: | ||
| message (str): The warning message to display. | ||
| verbose (bool): If True, the message will be printed. | ||
| """ | ||
| if verbose: | ||
| print(f"{sys.argv[0]} (info): {message}", file=sys.stderr) | ||
|
|
||
|
|
||
| def fasta_format(seq): | ||
| """ | ||
| Format sequence into lines of 60 characters each. | ||
|
|
||
| Args: | ||
| seq (str): sequence to format. | ||
| """ | ||
| return textwrap.wrap(seq, width=60, break_on_hyphens=False) | ||
|
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. This will probably cause problems with headers longer than 60. use biopython for io? |
||
|
|
||
|
|
||
| def one_line_fasta(input_fp, output_fp): | ||
|
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. Biopython instead of this workaround? |
||
| """ | ||
| Convert FASTA file to a format with sequences on single lines. | ||
|
|
||
| Args: | ||
| input_fp (Path): path to input FASTA file | ||
| output_fp (Path): path to output FASTA file | ||
| """ | ||
| with input_fp.open("r") as infile, output_fp.open("w") as outfile: | ||
| for line in infile: | ||
| if line.startswith(">"): | ||
| outfile.write(f"\n{line}") # Newline before header | ||
| else: | ||
| outfile.write(line.rstrip("\n")) # Remove newline and concatenate | ||
| outfile.write("\n") # Final newline (like END in awk) | ||
|
|
||
|
|
||
| def find_kmer_occurrences(begin, end): | ||
| """ | ||
| Find all starting positions of 'begin' in 'end'. | ||
|
|
||
| Args: | ||
| begin (): | ||
| end (): | ||
| """ | ||
| pattern = re.compile(re.escape(begin)) | ||
|
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. Why use regexp if you can use simple string search? |
||
| return [match.start() + len(begin) for match in pattern.finditer(end)] | ||
|
|
||
|
|
||
| def is_circular(line_chars, scale, pos): | ||
| """ | ||
| Check if the sequence is circular by comparing segments. | ||
|
|
||
| Args: | ||
| line_chars (list): Sequence characters | ||
| scale ( ): Starting k-mer | ||
| pos (): | ||
|
|
||
| Returns: | ||
| bool: True if circular, False otherwise | ||
| """ | ||
| for i in range(scale): | ||
| if line_chars[i] != line_chars[pos + i]: | ||
| return False | ||
| return True | ||
|
|
||
|
|
||
| def process_sequence( | ||
| line, | ||
| header, | ||
| verbose, | ||
| kmer_length=10, | ||
| cadre_length=0, | ||
| duplicate_nucleotides=1000, | ||
| ): | ||
| """ | ||
| Process a single sequence to detect circularity and modify if needed. | ||
|
|
||
| Args: | ||
| line (): | ||
| header (): | ||
| verbose (): | ||
| kmer_length (): | ||
| cadre_length (): | ||
| duplicate_nucleotides (): | ||
|
|
||
| Returns: | ||
| : True if circular, False otherwise | ||
| """ | ||
| try: | ||
|
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. This try just removes the traceback that could be useful for debugging. |
||
| line_chars = list(line) | ||
| seq_len = len(line_chars) | ||
|
|
||
| if seq_len < kmer_length: | ||
| warning(f"Short sequence ({seq_len}bp): {header}", verbose) | ||
| return None, None | ||
|
|
||
| # Determine cadre length | ||
| if cadre_length == 0 or cadre_length > seq_len - kmer_length: | ||
| cadre_length = seq_len - kmer_length | ||
|
|
||
| # Extract begin and end | ||
| begin = "".join(line_chars[:kmer_length]) | ||
| end_part = line_chars[-cadre_length:] # [::-1] | ||
| end_str = "".join(end_part) | ||
|
|
||
| # Find all positions where 'begin' appears in the reversed end part | ||
| end_positions = find_kmer_occurrences(begin, end_str) | ||
|
|
||
| if not end_positions: | ||
| return None, None | ||
|
|
||
| # Check for circularity at each position | ||
| status = False | ||
| for pos in end_positions: | ||
| scale = len(line_chars) - pos | ||
| if is_circular(line_chars, scale, pos): | ||
| status = True | ||
|
|
||
| if not status: | ||
| return None, None | ||
|
|
||
| # Modify the sequence | ||
| modified_seq = line_chars[: len(line_chars) - scale] | ||
|
|
||
| if len(modified_seq) < duplicate_nucleotides: | ||
| modified_seq += modified_seq | ||
| else: | ||
| modified_seq += line_chars[:duplicate_nucleotides] | ||
|
|
||
| return header, "".join(modified_seq) | ||
| except Exception as e: | ||
| error(f"Error processing sequence {header}: {e}") | ||
|
|
||
|
|
||
| def detect_circular( | ||
| fasta_in, | ||
| fasta_out, | ||
| id_out, | ||
| kmer_length=10, | ||
| cadre_length=0, | ||
| duplicate_nucleotides=1000, | ||
| verbose=False, | ||
| ): | ||
| """ | ||
| Detect and process circular sequences. | ||
|
|
||
| Args: | ||
| fasta_in (Path): Input FASTA file | ||
| fasta_out (Path): Output FASTA file with modifications | ||
| id_out (Path): File to record identifiers of circular sequences | ||
| kmer_length (int): Length of k-mer to search for | ||
| cadre_length (int): Length of sequence end to inspect | ||
| duplicate_nucleotides (int): Number of nucleotides to duplicate at the end | ||
| verbose (bool): Enable verbose output | ||
| """ | ||
| tmp_file = tempfile.NamedTemporaryFile(mode="w", delete=False) | ||
| one_line_fasta(fasta_in, Path(tmp_file.name)) | ||
|
|
||
| with Path(tmp_file.name).open("r") as infile, fasta_out.open( | ||
| "w" | ||
| ) as fasta_output, id_out.open("w") as id_output: | ||
|
|
||
| sequence = "" | ||
| header = "" | ||
| for line in infile.readlines(): | ||
| # print(line) | ||
| # Read header | ||
| if line.startswith(">"): | ||
| header = line[1:].strip() | ||
| sequence = "" | ||
| continue | ||
| else: | ||
| sequence = line.strip() | ||
|
|
||
| # Process the sequence | ||
| header, modified_seq = process_sequence( | ||
| sequence, | ||
| header, | ||
| verbose=verbose, | ||
| kmer_length=kmer_length, | ||
| cadre_length=cadre_length, | ||
| duplicate_nucleotides=duplicate_nucleotides, | ||
| ) | ||
|
|
||
| if modified_seq: | ||
| # Write to output files | ||
| id_output.write(f"{header}\n") | ||
|
|
||
| fasta_output.write(f">{header}\n") | ||
| formatted = fasta_format(modified_seq) | ||
| for line in formatted: | ||
| fasta_output.write(f"{line}\n") | ||
|
|
||
| # Clean up temporary file | ||
| Path(tmp_file.name).unlink() | ||
|
|
||
|
|
||
| def main(): | ||
| """ | ||
| Main function to detect circular contigs in a FASTA file. | ||
|
|
||
| This function parses command-line arguments, reads the input FASTA file, | ||
| processes each sequence to detect circular contigs, and prints the results. | ||
| It handles both verbose and non-verbose modes, and can optionally print only circular sequences. | ||
|
|
||
| Command-line arguments: | ||
| --fasta-in: Path to the input FASTA file (required). | ||
| --kmer-length: Length of the k-mer used to identify circular sequences (default: 10). | ||
| --cadre: Length of the fragment at the sequence 5' end to inspect for k-mer identity. | ||
| If 0, the entire sequence is screened (default: 0). | ||
| --only_circular: If set, only circular sequences are printed. | ||
| --verbose: If set, warning messages are printed during execution. | ||
| --output: Path to output file | ||
|
|
||
| The function processes each sequence in the FASTA file, checks for circularity, | ||
| and prints the results in FASTA format, with circular sequences marked in the header. | ||
| """ | ||
| parser = argparse.ArgumentParser( | ||
| description="Detect circular contigs by k-mer matching." | ||
| ) | ||
| parser.add_argument("--fasta-in", required=True, help="Input FASTA file") | ||
| parser.add_argument( | ||
| "--kmer-length", type=int, default=10, help="Length of k-mer (default: 10)" | ||
| ) | ||
| parser.add_argument( | ||
| "--cadre-length", | ||
| type=int, | ||
| default=0, | ||
| help="Inspect fragment length (default: 0)", | ||
| ) | ||
| parser.add_argument("--verbose", action="store_true", help="Enable verbose output") | ||
| parser.add_argument("--fasta-out", required=True, help="Output FASTA file") | ||
| parser.add_argument( | ||
| "--id-out", required=True, help="File to write circular sequence IDs" | ||
| ) | ||
|
|
||
| args = parser.parse_args() | ||
|
|
||
| warning("Starting script execution.", args.verbose) | ||
| detect_circular( | ||
| Path(args.fasta_in), | ||
| Path(args.fasta_out), | ||
| Path(args.id_out), | ||
| kmer_length=args.kmer_length, | ||
| cadre_length=args.cadre_length, | ||
| verbose=args.verbose, | ||
| ) | ||
| warning("Script execution completed.", args.verbose) | ||
|
|
||
|
|
||
| if __name__ == "__main__": | ||
| main() | ||
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,58 @@ | ||
| <tool id="detect_circular_sequences" name="Detect circular sequences" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> | ||
| <description> (e.g. circular contigs) in a FASTA file by k-mer matching</description> | ||
bgruening marked this conversation as resolved.
Outdated
Show resolved
Hide resolved
|
||
| <macros> | ||
| <token name="@TOOL_VERSION@">1.0</token> | ||
| <token name="@VERSION_SUFFIX@">0</token> | ||
| <token name="@PROFILE@">24.0</token> | ||
| </macros> | ||
| <requirements> | ||
| <requirement type="package" version="3.13">python</requirement> | ||
| </requirements> | ||
| <command><![CDATA[ | ||
| python '${__tool_directory__}/detect_circular_sequences.py' | ||
| --fasta-in '$fasta_in' | ||
| --kmer-length $kmer_length | ||
| --cadre-length $cadre_length | ||
| $verbose | ||
| --fasta-out '$fasta_out' | ||
| --id-out '$id_out' | ||
| ]]></command> | ||
| <inputs> | ||
| <param argument="--fasta-in" type="data" format="fasta" label="Input FASTA file"/> | ||
| <param argument="--kmer-length" type="integer" min="0" value="10" label="Length of k-mer"/> | ||
| <param argument="--cadre-length" type="integer" min="0" value="0" label="Inspect fragment length"/> | ||
| <param argument="--verbose" type="boolean" truevalue="--verbose" falsevalue="" default_value="" label="Inspect fragment length"/> | ||
| </inputs> | ||
| <outputs> | ||
| <data name="fasta_out" format="fasta" label="${tool.name} on ${on_string}: Circular sequences"/> | ||
| <data name="id_out" format="txt" label="${tool.name} on ${on_string}: Circular sequence IDs"/> | ||
| </outputs> | ||
| <tests> | ||
| <test expect_num_outputs="2"> | ||
| <param name="fasta_in" value="input.fasta"/> | ||
| <param name="kmer_length" value="10"/> | ||
| <param name="cadre_length" value="0"/> | ||
| <param name="verbose" value="false"/> | ||
| <output name="fasta_out"> | ||
| <assert_contents> | ||
| <has_text text=">SRR17300492_25544"/> | ||
| <has_text text="GCGATCCAACTGAACCGGATCTAGAGCCGTGGGGTCAACCGC"/> | ||
| </assert_contents> | ||
| </output> | ||
| <output name="id_out"> | ||
| <assert_contents> | ||
| <has_text text="SRR17300492_25544"/> | ||
| <has_n_lines n="1"/> | ||
| </assert_contents> | ||
| </output> | ||
| </test> | ||
| </tests> | ||
| <help><![CDATA[ | ||
| This script detect circular sequences (e.g. circular contigs) by looking for exact identical k-mer at the two | ||
| ends on a cadre sequence of the sequences prodvide in fasta file. In order to be able | ||
| to predict genes spanning the orgin of circular sequences, the first 1,000 nucleotides | ||
| of each circular sequence are duplicated and added at the sequence's end. | ||
|
|
||
| Inspired by Simon Roux work for Metavir2 (2014) and Corentin Hochart work in PlasSuite | ||
| ]]></help> | ||
| </tool> | ||
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
cadre?