Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.3.2 to 0.3.3

[gxydevbot]

Hello! This is an automated update of the following workflow: workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

• toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.9+galaxy0

The workflow release number has been updated from 0.3.2 to 0.3.3.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-only-VGP3.ga_0

  Execution Problem:

  • Failed to run workflow, invocation ended in [failed] state.
    

  Workflow invocation details

  • Invocation Messages

  • Steps

    • Step 1: Species Name:

      • step_state: scheduled

    • Step 2: Assembly Name:

      • step_state: scheduled

    • Step 11: Name of primary assembly:

      • step_state: scheduled

    • Step 12: Name of alternate assembly:

      • step_state: scheduled

    • Step 13: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "Random Name", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 14: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "randName4", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 15: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • ln -f -s '/tmp/tmp4ybfq0c6/files/e/d/2/dataset_ed278678-26ba-467a-8c5f-ef335328893a.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 16: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp4ybfq0c6/files/9/9/b/dataset_99b97278-abee-40cb-9dde-c664f4afe7b4.dat' > '/tmp/tmp4ybfq0c6/job_working_directory/000/8/outputs/dataset_e201b2f8-d89e-47c8-b08c-336eeb6e89ab.dat'

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 17: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}, {"__index__": 1, "value": "37"}]}}

    • Step 18: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 19: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is queued

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            components	[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "vertebrata_odb10", "select_param_type": "text"}}]
            dbkey	"?"

    • Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            image_content_input	None
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}]
            title	""

    • Step 3: Pacbio Reads Collection:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.5+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": "", "sed_options": null}, {"__index__": 1, "find_pattern": ",", "replace_pattern": "", "sed_options": null}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2", "sed_options": null}]

    • Step 22: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 23: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 24: param_value_from_file:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 25: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 26: Homozygous read coverage for Hifiasm:

      • step_state: new

    • Step 27: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is new

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"bf47cd9c606e11f08b817c1e52df0911"
            chromInfo	"/tmp/tmp4ybfq0c6/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 28: Unlabelled step:

      • step_state: new

    • Step 29: Raw Unitig Image:

      • step_state: new

    • Step 30: Unlabelled step:

      • step_state: new

    • Step 4: Meryl Database:

      • step_state: scheduled

    • Step 31: Unlabelled step:

      • step_state: new

    • Step 32: Unlabelled step:

      • step_state: new

    • Step 33: Unlabelled step:

      • step_state: new

    • Step 34: Unlabelled step:

      • step_state: new

    • Step 35: Unlabelled step:

      • step_state: new

    • Step 36: Unlabelled step:

      • step_state: new

    • Step 37: Unlabelled step:

      • step_state: new

    • Step 38: Unlabelled step:

      • step_state: new

    • Step 39: Unlabelled step:

      • step_state: new

    • Step 40: Unlabelled step:

      • step_state: new

    • Step 5: Genomescope Summary:

      • step_state: scheduled

    • Step 41: Unlabelled step:

      • step_state: new

    • Step 42: Unlabelled step:

      • step_state: new

    • Step 43: Unlabelled step:

      • step_state: new

    • Step 44: Unlabelled step:

      • step_state: new

    • Step 45: Data Prep Primary:

      • step_state: new

      • Subworkflow Steps

    • Step 46: Data Prep Alternate:

      • step_state: new

      • Subworkflow Steps

    • Step 47: merqury_qv:

      • step_state: new

    • Step 48: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 49: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 50: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 6: Bits for Hifiasm bloom filter:

      • step_state: scheduled

    • Step 51: merqury_stats:

      • step_state: new

    • Step 52: Unlabelled step:

      • step_state: new

    • Step 53: Plotting Nx and Sizes:

      • step_state: new

      • Subworkflow Steps

    • Step 54: Unlabelled step:

      • step_state: new

    • Step 55: Unlabelled step:

      • step_state: new

    • Step 7: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 8: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 9: Database for Busco Lineage:

      • step_state: scheduled

    • Step 10: Lineage:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Failed to run workflow, invocation ended in [failed] state.

    • history_id

      • b35356429719357b

    • history_state

      • ok

    • invocation_id

      • b35356429719357b

    • invocation_state

      • failed

    • workflow_id

      • 1a040fb6856ddbec