Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
2 changes: 1 addition & 1 deletion tests/test_assembly.py
Original file line number Diff line number Diff line change
Expand Up @@ -54,7 +54,7 @@
from .graph_features import K


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
4 changes: 2 additions & 2 deletions tests/test_countgraph.py
Original file line number Diff line number Diff line change
Expand Up @@ -62,7 +62,7 @@
DNA = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"


def teardown():
def teardown_module():
utils.cleanup()


Expand Down Expand Up @@ -116,7 +116,7 @@ def test_revhash_1():

class Test_Countgraph(object):

def setup(self):
def setup_method(self):
self.hi = khmer.Countgraph(12, 1, 1, primes=PRIMES_1m)

def test_failed_get(self):
Expand Down
4 changes: 2 additions & 2 deletions tests/test_counting_single.py
Original file line number Diff line number Diff line change
Expand Up @@ -329,7 +329,7 @@ def test_very_short_read():

class Test_ConsumeString(object):

def setup(self):
def setup_method(self):
self.kh = khmer.Countgraph(4, 1, 1, primes=[4 ** 4])

def test_n_occupied(self):
Expand Down Expand Up @@ -374,7 +374,7 @@ def test_max_count(self):

class Test_AbundanceDistribution(object):

def setup(self):
def setup_method(self):
self.kh = khmer.Countgraph(4, 100, 1)
A_filename = utils.get_test_data('all-A.fa')
self.kh.consume_seqfile(A_filename)
Expand Down
2 changes: 1 addition & 1 deletion tests/test_cython_parsing.py
Original file line number Diff line number Diff line change
Expand Up @@ -16,7 +16,7 @@
import screed


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
6 changes: 3 additions & 3 deletions tests/test_graph.py
Original file line number Diff line number Diff line change
Expand Up @@ -41,13 +41,13 @@
from . import khmer_tst_utils as utils


def teardown():
def teardown_module():
utils.cleanup()


class Test_ExactGraphFu(object):

def setup(self):
def setup_method(self):
self.ht = khmer.Nodegraph(12, 1e4, 2)

def test_counts(self):
Expand Down Expand Up @@ -141,7 +141,7 @@ def test_graph_links_prev_t(self):

class Test_InexactGraphFu(object):

def setup(self):
def setup_method(self):
self.ht = khmer.Nodegraph(12, 4 ** 3 + 1, 2)

def test_graph_links_next_a(self):
Expand Down
2 changes: 1 addition & 1 deletion tests/test_hll.py
Original file line number Diff line number Diff line change
Expand Up @@ -50,7 +50,7 @@
TRANSLATE = {'A': 'T', 'C': 'G', 'T': 'A', 'G': 'C'}


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
2 changes: 1 addition & 1 deletion tests/test_labelhash.py
Original file line number Diff line number Diff line change
Expand Up @@ -44,7 +44,7 @@
from . import khmer_tst_utils as utils


def teardown():
def teardown_module():
utils.cleanup()

#
Expand Down
2 changes: 1 addition & 1 deletion tests/test_nodegraph.py
Original file line number Diff line number Diff line change
Expand Up @@ -48,7 +48,7 @@
from . import khmer_tst_utils as utils


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
2 changes: 1 addition & 1 deletion tests/test_sandbox_scripts.py
Original file line number Diff line number Diff line change
Expand Up @@ -55,7 +55,7 @@ def scriptpath(script):
return script


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
2 changes: 1 addition & 1 deletion tests/test_scripts.py
Original file line number Diff line number Diff line change
Expand Up @@ -51,7 +51,7 @@
import screed


def teardown():
def teardown_module():
utils.cleanup()


Expand Down
2 changes: 1 addition & 1 deletion tests/test_subset_graph.py
Original file line number Diff line number Diff line change
Expand Up @@ -43,7 +43,7 @@
from . import khmer_tst_utils as utils


def teardown():
def teardown_module():
utils.cleanup()


Expand Down