ThesisTemplate.rtf

{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf230
{\fonttbl\f0\froman\fcharset0 TimesNewRomanPSMT;\f1\fmodern\fcharset0 CourierNewPSMT;\f2\ftech\fcharset77 Symbol;
\f3\fmodern\fcharset0 CourierNewPS-BoldMT;\f4\fnil\fcharset0 STIXGeneral-Regular;}
{\colortbl;\red255\green255\blue255;\red191\green191\blue191;\red255\green0\blue0;}
{\info
{\title Original file was ThesisTemplate.tex}
{\doccomm Created using latex2rtf 2.1.0 (released Mar  5 2010) on Tue Dec 13 17:01:07 2011}}\paperw12280\paperh15900\margl2680\margr2700\margb1760\margt2540\vieww18780\viewh13200\viewkind0
\deftab720
\pard\pardeftab720\fi360\qj

\f0\fs20 \cf0 nature \
\pard\pardeftab720\fi360\sa120\qc
\cf0 \
\pard\pardeftab720\qc
\cf0 [Sorry. Ignored 
\f1\fs24 \\begin\{singlespace\} ... \\end\{singlespace\}
\f0\fs20 ]\
\pard\pardeftab720\sb2890\qc
\cf0 [Sorry. Ignored 
\f1\fs24 \\begin\{singlespace\} ... \\end\{singlespace\}
\f0\fs20 ]\
\pard\pardeftab720\sb722\qj
\cf0 This is where the abstract goes\
\pard\pardeftab720\qc
\cf0 [Sorry. Ignored 
\f1\fs24 \\begin\{singlespace\} ... \\end\{singlespace\}
\f0\fs20 ]\
\pard\pardeftab720\sb120\sa120\qc

\fs48 \cf0 Acknowledgement
\fs20  \
\pard\pardeftab720\qj
\cf0 I would like to extend my thanks to yada yada yada (maybe your parents? )\
More thankful yada...\
Even more yada...\
\pard\pardeftab720\sb4336\sa120\qc
\cf0 Dedicated to\
\pard\pardeftab720\sb120\sa120\qc
\cf0 Laura Bennett. This one\'92s fer you kid. \
\pard\pardeftab720\qj
\cf0 \page \pard\pardeftab720\sb240\sa120

\b \cf0 Chapter 1\
\pard\pardeftab720\sb240\sa120

\fs40 \cf0 Introduction\
\pard\pardeftab720\sb240\qj

\b0\fs24 \cf0 In 1983, two events of note occurred; the first being my birth, and the second, the publishing of an article in Nature by (38) which showed that inositol(1,4,5)-trisphosphate (IP3) triggered the release of calcium (Ca) from the endoplasmic reticulum (ER). A few years later, in 1986, (31), proposed that depletion of 
\b [
\b0 Ca
\b ]
\b0  signaled the plasma membrane Ca entry channels to open (39). This and other early studies (17, 49) formed the basis for what we now refer to as store-operated calcium entry (SOCE). Initially, the more popular term used was capacitative calcium entry (CCE). Over 20 years later, the other major players in this story came into the view. Stromal interaction molecule 1 (STIM1), was found to affect SOC influx in an RNA screen and identified as the ER calcium sensor (33, 22, 48). Shortly thereafter, Orai1 was found and identified as the store-operated calcium channel (29, 41, 14, 47, 36). \
\pard\pardeftab720\fi40\qj
\cf0 The mammalian Orai1 has two homologs, Orai2 and Orai3, whose functions have not yet been clarified (33, 41, 39, 36). It may be the case that the proteins encoded by these genes are expressed in a tissue-specific manner. This seems to be the case with estrogen receptor-positive (ER+) breast cancer cells, which have been shown to use Orai3 as their store-operated Ca channel (10). The demonstrable involvement of Orai3 in a disease state as prevalent as breast cancer, underscores the importance of further studies of these Orai channels whose function in the body is not yet understood. The presented study sets the foundation for performing a pharmacological characterization of the Orai3 Ca channel, by using 
\i Drosophila
\i0  S2 cells as a heterologous expression system. This system is expected to be of more general use for physiological and pharmacological studies of all Orai channels. We begin by introducing calcium signaling through store-operated channels in non-excitable cells. \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.1  Background\
\pard\pardeftab720\sb180\sa120
\cf0 1.1.1  Calcium Signaling\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Ultimately we will be looking at the effect which 2-APB has on Orai3, using cellular Ca elevations as our output. Ca is an incredibly versatile signaling molecule, affecting all parts of the cellular signaling machinery. Ca signaling is critical to such processes as exocytosis, transcription, cardiac function, mitosis and apoptosis (4, 5, 16, 36). The speed of these processes range from seconds to minutes to days (4). \
\pard\pardeftab720\fi40\qj
\cf0 Orai3 is in the same family as Orai1 (14, 39, 16), the recently identified Calcium-Release Activated Calcium (CRAC) channel, and is thought to be related to store-operated calcium entry (SOCE). It is important then to understand the role that Ca plays in this process. Cell calcium sources are both internal and external (4, 5, 36). It is necessary then, to maintain a balance between the two pathways, to prevent calcium from accumulating where it should not, thereby activating or deactivating cellular processes at inopportune times. The internal source of calcium we will be looking at is the endoplasmic reticulum (ER). The ER releases Ca from its stores through Ca-permeable channels, the most studied of them being the IP3 and ryanodine receptors (IP3R, RYR) (5, 6). These channels are in fact activated via second messengers. IP3R, for example, is activated by IP3 and this opens the channel releasing ER Ca into the cytoplasm. IP3 is the soluble product of phosphatidylinositol(4,5)diphosphate (PIP2) cleavage by phospholipase C gamma (PLC) in T-lymphocytes (5, 21). \
\'93On\'94 mechanisms are the means by which Ca is released from internal stores into the cytoplasm. \'93On\'94 mechanisms depend on Ca channels (5) which may be voltage-operated channels (VOCs), receptor-operated channels, and/or store-operated channels (SOCs) (5). Orai1 is a store-operated Ca channel (29, 41, 14, 47, 36). \
\'93Off\'94 mechanisms also exist to quickly lower 
\b [
\b0 Ca
\b ]
\b0 , and this is done through various pumps and exchangers (5). The plasma membrane Ca-ATPase and Na/Ca exchanger will move Ca out of the cell, while the sarco-endoplasmic reticulum Ca ATPase will pump Ca back into the ER, replenishing the cell\'92s internal stores (5).\
When SOCs open they allow Ca into the cytosol. This leads to 
\b [
\b0 Ca
\b ]
\b0  increasing from nanomolar to micromolar levels (5). Ca is both stimulatory and inhibitory (5), since Ca acts as a signal for such a wide array of cellular processes. Spatial regulation then, is very important, and serves as a way to control Ca-dependent mechanisms. Ca-binding proteins, which act as buffers, provide a way for the cell to control the local 
\b [
\b0 Ca
\b ]
\b0 . Cytosolic Ca buffers such as parvalbumin, calbindin-D, and calreticulin, (5) along with Ca pumps and exchangers become important regulators of 
\b [
\b0 Ca
\b ]
\b0 . \
Cytosolic Ca binding proteins are capable of more then buffering; they can also act as Ca sensors (5). Ca sensors, such as troponin C and calmodulin, respond to changes in 
\b [
\b0 Ca
\b ]
\b0 . They do so with the aid four EF hand motifs and will bind Ca to undergo conformational changes, and then activate downstream processes (5). This mechanism of detecting changes in 
\b [
\b0 Ca
\b ]
\b0  should be emphasized, as it will become relevant for another player in the SOCE mechanism, STIM1.\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.1.2  Store-Operated Calcium Entry\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Store-operated calcium entry is an interesting, yet simple process. Broken down to its simplest form, it is merely a process which signals Ca to enter the cell when it is in need of more Ca(31, 5, 21). What triggers the process is the loss of Ca from the cell\'92s own internal Ca stores. This increases the intracellular Ca and allows for replenishing the stores (39), as well as providing Ca necessary for various cellular processes (4, 5, 16, 36). Store-operated Ca channels in lymphocytes are responsible for Ca entering from extracellular fluid (i.e. blood) (21, 5, 16). This sustained Ca influx is necessary for gene transcription driven by nuclear factor of activated T-cells (NF-AT) (40, 5, 21, 16). NF-AT, a transcription factor, is activated when an immune response is necessary, and drives the transcription of IL-2 genes (40, 21, 16). The importance of Ca to this process is a result of NF-AT\'92s dependence on calcineurin for activation. \
\pard\pardeftab720\fi40\qj
\cf0 The Ca release triggered by SOCE results in Ca and calmodulin binding to calcineurin and activating it. Activated calcineurin then dephosphorylates NF-AT, allowing it to move into the nucleus (2). Once inside the nucleus, NF-AT is able to bind the promoter region of interleukin and proliferation genes enabling their transcription; in effect triggering immune response (40, 5, 16). Notice that for efficient NF-AT activation, the Ca elevation needs to be sustained, for 1-2 hours (40, 5, 21). \
Now that we have presented a general idea of SOCE it will hopefully be easier to understand the mechanism. T-cell receptor engagement activates the enzyme phospholipase C gamma (PLC). PLC will then hydrolyze phosphatidylinositol 4,5-bisphosphate (PIP2) resulting in soluble IP3, and membrane bound diacylglycerol (DAG) (5, 21). The IP3 binds to IP3 receptor (IP3R) opening it and allowing Ca out of the ER down its concentration gradient (36, 39, 21). The decrease in 
\i Drosophila
\i0  ER calcium is detected, and serves as a signal for extracellular Ca flow in through the plasma membrane (PM) (36). \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.2  STIM1\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Stromal interaction molecule 1 (STIM1), initially discovered as a transmembrane protein (42), was later shown to act as a sensor for Ca within the ER (33, 22, 48, 36). The related STIM2 and 
\i Drosophila
\i0  STIM (
\i dStim
\i0 ) were also discovered (42).\
\pard\pardeftab720\fi40\qj
\cf0 STIM1 is able to function as a Ca sensor due to its EF hand (42, 22), which is a motif also present in cytosolic Ca sensors (see above). Upon depletion, ER-localized STIM1 will migrate to sites at or near the plasma membrane and, through interactions with SOCE channels, will somehow help in activation of these channels. Once activated, channels in the Orai family - Orai1 being the only one which is both necessary and sufficient for Ca entry - allow Ca into the cell. STIM2, meanwhile, was found to be an inhibitor of STIM1-mediated SOCE (37). 
\i dStim
\i0  while an important regulator of SOCE is also important in 
\i Drosophila
\i0  developmentally (13). STIM1 and STIM2 are single-pass transmembrane proteins (16). Both are ER localized proteins, until emptying of the ER Ca store causes translocation into, or close to, the plasma membrane (16). \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.3  Orai3\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 As mentioned previously, the Orai3 channel belongs to a family whose primary member, Orai1, has been identified as the long sought after store operated calcium (SOC) channel (14, 16). This is why studying Orai3 is important. \
\pard\pardeftab720\fi40\qj
\cf0 In this study we will seek to determine some properties of Orai3. In the mammalian system, a drug named 2-APB will, at low concentrations activate Orai1 but at higher concentrations inactivate it (14). 2-APB was shown to activate Orai3 at concentrations of 50 or 100 \uc0\u956 M in the mammalian system however (46). \
We already know some parts of the equation, but even now, years after its discovery, the field still has a poor understanding of Orai3\'92s function. It is known that Orai3 can take part in interactions similar to that of Orai1. One of those, an interaction with the chemical 2-APB results in different cellular responses depending on the protein to which it binds. While Orai1 will see a slight activation upon introduction of < 30 \uc0\u956 M amounts of 2-APB to its cellular milieu (15, 29), introduction of higher concentrations (> 30 \u956 M) results in deactivation (15, 46), and blockade of SOCE. Orai3 on the other hand is activated by concentrations around 50 \u956 M (15, 46). This is suggestive of direct interactions with 2-APB, which if true could help glean new information about Orai3 structure. If the interactions are direct, crystal structures with 2-APB could help define the structure of this binding site, and lead to information helpful in finding the natural modulator of this SOCE activating function. It is evident then, that the question of whether Orai3 interacts directly with 2-APB is an important one. The Orai family of proteins displays a wide expression profile, which includes T-cells and kidney (16). In HEK293 cells, knock down of Orai1 using siRNA reduced SOCE (16). Knock down of Orai2 or Orai3 did not significantly affect SOCE, however (16). These experiments in HEK cells are suggestive of Orai1\'92s importance in initiating SOCE. As long as Orai1 is around, then SOCE takes place normally. Overexpression experiments of Orai1 showing Ca influx for minutes support this idea (16, 46). Ca influx on the order of hours is necessary for gene transcription however. \
Expression of Orai3 and STIM1 in SCID T-cells results in marginal increases in SOCE, far lower than when Orai1 and Stim1 are overexpressed (16). In SCID patient fibroblast cells only Orai3 showed a minor increase in SOCE, over basal levels (16). Orai2 and Stim1 expression did not result in any increase over the basal SCID T-cell levels. These experiments indicate that while Orai2 and Orai3 are, at some level, capable of allowing SOCE, in these cell types they are not the primary mediators of SOCE. \
These results may be taken to suggest that Orai3 is potentially important to SOCE in cell types that do not rely on Orai1 for sustained Ca levels, as T-cells do. An example of this has been displayed for ER+ cancer cells. This shows that Orai3, by itself, is an important target of scientific inquiry, and that finding ways to ease its study is a relevant and valuable endeavor. In this study we begin this process by attempting to create a model system for studying pharmacological effects on Orai3.\
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.4  
\i Drosophila
\i0  S2 cells\
\pard\pardeftab720\sb60\qj

\i\b0\fs24 \cf0 Drosophila
\i0  cell line 2 (S2) has risen to prominence due to the ease of expressing proteins from other organisms in them. S2 cells have been used for both transient and stable expression of recombinant proteins (34). They are also easy to transfect and allow multiple copies of plasmid DNA to stably integrate into the genome (34). This property results in high levels of protein production which make them so attractive to use. The S2 cell line is derived from late stage 
\i Drosophila
\i0  melanogaster embryos (35, 34). Schneider, the creator, described them as macrophage-like (34) and evidence for their immune lineage includes the following: [(i)] 1. they undergo phagocytosis (34); 2. produce antibacterial proteins (34); 3. like mammalian macrophages prefer media with more carbonate (34), and 4. will phagocytize other dying S2s.  \
\pard\pardeftab720\fi40\qj
\cf0 Another reason why S2 cells present an attractive target for protein expression is related to the possibility of finely regulating protein expression through the use of vectors with strong, inducible promoters (34, 44). Another contributing factor to the use of S2 cells in this study was the prevalence of multiple isoforms of Orai and Stim genes in mammalian cells. Humans alone have three Orais: Orai1, Orai2 and Orai3; and two STIMs: STIM1 and STIM2 In contrast, S2 cells have only one Orai (dOrai) and one STIM (dSTIM). There are other advantages to using the 
\i Drosophila
\i0  S2 cell line as well. The lack of response to high K makes S2\'92s good for transient or stable expression of ionotropic receptors (9). S2s also lack major contaminating currents from other channel types (44, 33). The S2 cell population is known to display stable behavior over time (3). As with other immortalized cells, they can be frozen and used at later times. Another advantage is that it is possible to follow the responses of a population immediately after adding a drug (3). The addition of genes, either transiently or stably has been well documented. It is possible to do so quickly and easily. The silencing of gene function by RNA interference (RNA) is also relatively simple and well characterized in these cells (33). All of these factors make the 
\i Drosophila
\i0  Expression System (DES) very attractive to work with.\
In our studies we will be introducing genes and testing their function. Ultimately, our goal is to generate stable cell lines expressing our mammalian genes, and use this system for the purpose of drug discovery. DES also allows for fine grained control of genes of interest (GOI) by using appropriate promoters to drive gene expression. In our system, we have selected the metallothionein promoter to drive expression of our GOIs in a regulated fashion. The introduction of mammalian ion channels and receptors using such a system has been demonstrated previously (34, 18, 1, 20, 28).\
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.5  Metallothionein\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 The 
\i Drosophila
\i0  metallothionein (Mtn) promoter is a strong inducible promoter (34, 7, 26, 44). Experimentally Cu at concentrations \uc0\u8805  500 \u956 M will strongly activate Mtn; with basal activity being reported as close to undetectable (34). At the concentrations of Cu that will induce the Mtn promoter, S2 cells can grow and make proteins (34).\
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.6  Chemical reagents used\
\pard\pardeftab720\sb300\qc

\b0\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 [Fura2-AM] \'ef\'bf\'bc   [CPA]   \
\pard\pardeftab720\fi40\sb120\sa120\qc
\cf0 [Probenecid]   [2-APB]   \
\pard\pardeftab720\sb120\sa120
\cf0 Figure 1.1: Structures of chemical reagents used in this study.\
\pard\pardeftab720\sb360\sa120

\b\fs32 \cf0 1.6.1  2-Aminoethoxyphenyl Borate\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 2-aminoethoxyphenyl borate (2-APB) (CAS Number: 524-95-8, (CH)BOCHCHNH) is a drug which has multiple effects on a variety of cellular organelles. It is an inhibitor of IP3Rs, SERCA pumps, and has both activating and inhibitory effects on channels (30, 6, 10). Its ability to activate and inhibit Orai channels will be exploited in this study. Its effect on Orai1 channels is to activate them at concentrations of 5 \uc0\u956 M, while inhibiting at concentrations of 30 M or greater (16, 15). This dual effect is limited to Orai1, whereas for Orai3, 2-APB only activates at concentrations \u8805  50 \u956 M (16). \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.6.2  Cyclopiazonic Acid\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Cyclopiazonic Acid (CPA) (CAS Number: 18172-33-3, CHNO) is a specific inhibitor of the endoplasmic reticulum\'92s Ca ATPase (27). It has only been shown to inhibit the ER Ca ATPase (SERCA Pump), and has been shown not to affect other ATPases or calcium pumps (27). The affinity of CPA for its substrate is 120 nM. The use of CPA allows for manipulation of SERCA pumps and by extension the ER Ca store (32). Inhibition of the SERCA pump by CPA leads to release of the ER Ca pools typically under the control of IP3R, (32). The SERCA pump inhibition reveals a persistent Ca leak from the ER, and makes it the predominant force driving Ca movement. The result is an increase of cytoplasmic Ca as Ca leaks from ER into cytoplasm. Ca release occurs relatively quickly, as CPA is membrane permeant (32). \
\pard\pardeftab720\fi40\qj
\cf0 CPA is added in a Ca free solution containing a Ca chelator. We then switch to a solution that contains Ca, with no CPA. By emptying the cell\'92s intracellular stores first, we may then reasonably assume that any subsequent increase in 
\b [
\b0 Ca
\b ]
\b0  is the result of Ca coming into the cell from the external solution. \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.6.3  Ethylene glycol tetraacetic acid\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Ethylene Glycol Tetraacetic Acid (EGTA) is a cation chelator with a preference for Ca over Mg, Na and K (19). It is used experimentally to bind available Ca in the extracellular solution, making it unavailable for entry into the cell. This ensures that when 
\b [
\b0 Ca
\b ]
\b0  increases are seen during perfusion with a solution containing EGTA, we can assume that these increases are the result of intracellular Ca release, rather than extracellular Ca entry (19, 32).\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.6.4  Fura-2\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 The ability to measure 
\b [
\b0 Ca
\b ]
\b0  changes comes from our use of Fura-2. Fura-2 is a calcium indicator whose ability to bind calcium is the result of a tetracarboxylic acid core. It is a BAPTA derivative, which in turn, is based on EGTA\'92s structure (19, 32). \
\pard\pardeftab720\fi40\qj
\cf0 Fura-2 is a dual excitation indicator with a Kd of 145 nM for Ca. At low [Ca] excitation peaks at approximately 370 nm, while binding Ca changes the excitation peak to 340 nm. Emission, meanwhile, is monitored at 510 nm. This results in Ca binding leading to an increase in fluorescence at 510nm, when Fura-2 is excited at 340 nm. There is a corresponding decrease in fluorescence at 510 nm, when excited at 380 nm if Ca is bound. By exciting both wavelengths in quick succession, Ca binding changes can be monitored. This is referred to as a ratiometric approach, and has advantages over single wavelength excitation (discussed in (19)). \
The advantages are that the signal is not dependent on the dye concentration, illumination intensity or optical path-length because we get normalized values from the ratios of the two wavelengths. Dye leakage and photobleaching both lead to a loss of indicator 
\i during
\i0  the experiment. The ratiometric measurements are therefore an improvement over the single wavelength readings with respect to these issues as well. In a single wavelength setup, the dye concentration would gradually decrease, leading to a seeming decrease in Ca signal. In the ratiometric setup, the effect of dye leakage or photobleached signals is mitigated by taking the ratios of these measurements. The ratios should remain constant regardless of the dye concentration or signal intensity. As an added bonus, ratiometric measurements also increase sensitivity. (19).\
One noteworthy drawback is that Fura-2 fluorescence can be quenched by Cu (32, 26). Since we use CuSO to induce gene expression in S2 cells, this is directly relevant to our study. Care therefore is taken with measurements from CuSO-induced S2 cells. These cells are spun down, washed in PBS, and then resuspended in S2 media containing no CuSO to minimize quenching. \
\pard\pardeftab720\sb120\sa120

\b \cf0 Fura-2-AM\
\pard\pardeftab720\sb60\qj

\b0 \cf0 Ca indicators are, necessarily, charged molecules. In spite of this, we them to cross the lipophilic PM. Since diffusional transport of these large, charged molecules across the lipophilic membrane would be extremely slow, other methods are used to speed up the process. By esterification of the -COOH groups of Fura-2, these groups are made lipophilic and thus membrane permeant. Indicators with these modifications already made are usually available as acetoxymethyl (AM) esters. Such is the case here, and the Fura-2-AM variant is used to load the dye into our S2 cells. Once inside the cells, cytosolic esterases are needed to remove the AM groups. Once these groups are removed, Fura-2 regains its charge, and may no longer freely cross the PM. \
\pard\pardeftab720\fi40\qj
\cf0 One caveat of this method is that cell types with poor esterase activity will display poor loading (19). Another is that cellular processes, presumably designed to maintain ionic equilibrium, may pump the de-esterified, charged compound out of the cell. To combat this problem, the anion transporters responsible for this process can be blocked. This strategy was found to be necessary for S2 cells (9). Probenecid was used for this purpose in our study.\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.6.5  Probenecid\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Probenecid (CAS Number: 57-66-9, CHNOS) is a nonspecific inhibitor of anion transport (9, 24). The reason for wanting to inhibit anion transport is to prevent cells from transporting the Fura-2 dye out of the cytosol. Many cell types are capable of sequestering the dye into different compartments, and also of transporting the dye out of the cell (11). There are a number of methods proposed for how Fura-2\'92s cytosolic concentration could be reduced (11, 9). Of those, the hypothesis that anion transporters, which probenecid would block, is responsible seems most plausible in 
\i Drosophila
\i0  S2 cells (9). Killer T-cells and murine macrophages have also shown a propensity for Fura-2 leakage (11). In the mouse macrophage model, the anion transporters were again been implicated in Fura-2 leakage and blocking anion transport in mouse macrophages prevented Fura-2 sequestration and secretion (11). It is easy to see then that S2 cells, which are also from an immune lineage (34), would have a similar response.\
\pard\pardeftab720\fi40\qj

\i \cf0 Drosophila
\i0  S2 cells have, in fact, been shown to exhibit this problem with poor loading of Fura-2; one alleviated by the addition of probenecid (9). In our experiments we also experienced similar difficulties with loading the S2 cells in the absence of an anion blocker. Addition of 2.5 mM of probenecid alleviated this problem, increasing the number of cells loaded with Fura-2.\
\pard\pardeftab720\sb120\sa120

\b \cf0 The mode of action of Probenecid\
\pard\pardeftab720\sb60\qj

\b0 \cf0 Probenecid is thought to act by inhibiting the clearance of ions (24). It has also been reported that the drug has non-specific effects, among them an altering of the Ca homeostasis (24). Such information is important to be aware of, as Ca measurements are the output from the experiments in our study. Care needs to be taken then, to ensure that the Ca measurements would not be affected by probenecid. We address this by doing short 45-minute incubations in probenecid similar to other published studies (33, 9), followed by washing these cells in our perfusion solution without probenecid.\
\pard\pardeftab720\fi40\qj
\cf0 Probenecid is soluble at alkali basic pH. It is therefore dissolved in a solution of NaOH. This necessitates titrating the dye loading solution back to the desired pH, after adding probenecid (11). In mouse macrophage experiments, no unexpected effects on cell viability after a 
\i 3 hr
\i0  incubation with probenecid were observed (11). While there are caveats to its use, incubation at room temperature and for short periods, does not appear to affect cell viability or function (11, 9, 45). \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.7  Specific Aims\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Before we were able to characterize Orai3 Ca channels in 
\i Drosophila
\i0  S2 cells, we needed to create the insect vector which contained our mammalian GOI. Standard molecular biology techniques were used to achieve this. The pharmacological characterization was done by measuring the effect of 2-Aminoethoxyphenyl Borate (2-APB) on heterologously expressed Orai3 activity. \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.7.1  Specific Aim #1\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Specific aim #1 is to create vector constructs which express Orai3 and Stim1 in 
\i Drosophila
\i0  S2 cells. \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.7.2  Specific Aim #2\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 After creating these vector constructs it will be necessary to determine if they are functional. Specific aim #2 is to show that we can successfully express heterologous genes in S2 cells.\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 1.7.3  Specific Aim #3\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 It is our desire to ultimately use this system for drug discovery. For this to be possible we need to assess the effects which different drugs have in our system. This will be done using Ca measurements taken in transfected 
\i Drosophila
\i0  S2 cells. Specific aim #3 then, will assess the effect which 2-APB has on the heterologously expressed Orai3 channel. 2-APB is a pharmacological agent with defined effects on the Orai3 Ca channel. By looking at the effect of 2-APB on heterologously expressed Orai3, we will be able to determine whether the model requires refinement, or is suitable as is.\
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 1.8  Significance\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 As stated above, Orai3 Ca channels have been implicated in a specific subset of breast cancer. It is tempting to envision a scenario where we can specifically target a breast cancer for treatment (10). This will require some way to test the efficacy of drugs being used, however. If successful, creating a model system in 
\i Drosophila
\i0  has the possibility to simplify drug testing, and as a result speed the process up. This could benefit research of, not only breast cancer, but also other diseases affected SOCE Ca. Cancers, such as leukemia, and even autoimmune diseases such as rheumatoid arthritis or lupus, arising from defects of the immune system stand to benefit from this work.\
\page \pard\pardeftab720\sb240\sa120

\b\fs40 \cf0 Chapter 2\
Materials and Methods\
\pard\pardeftab720\sb480\sa120

\fs32 \cf0 2.1  Materials\
\pard\pardeftab720\sb300\qc

\b0\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.1: List of Cloning Reagents\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Manufacturer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Item\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Location\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*5 Prime\cell 
\pard\intbl\itap1\pardeftab720
\cf0 PerfectPrep EndoFree Plasmid Maxi Kit\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*Gaithersburg, MD\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Agarose Gelextract Mini Kit\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Agilent Technologies\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Easy-A One-Tube RT-PCR Kit\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Santa Clara, CA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Ambion\cell 
\pard\intbl\itap1\pardeftab720
\cf0 TRI Reagent
\fs20 \up8 \'ae
\fs24 \up0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Austin, TX\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Fermentas\cell 
\pard\intbl\itap1\pardeftab720
\cf0 DNase I, RNase-free\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Glen Burnie, MD\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 IBI Scientific\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Ethidium Bromide (EtBr)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Peosta, IA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Invitrogen\cell 
\pard\intbl\itap1\pardeftab720
\cf0 MAX Efficiency
\fs20 \up8 \'ae
\fs24 \up0  DH10\uc0\u946  Competent cells\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Carlsbad, CA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*Lucigen\cell 
\pard\intbl\itap1\pardeftab720
\cf0 2.5 mM dNTP Mix\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*Middleton, WI\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 EconoTaq PLUS GREEN 2X Master Mix\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Promega\cell 
\pard\intbl\itap1\pardeftab720
\cf0 PureYield
\fs20 \up8 \'99
\fs24 \up0  Plasmid Miniprep System\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Madison, WI\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Research Products\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Agarose\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*Mount Prospect, IL\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*International (RPI)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Tryptone\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Yeast Extract\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*New England Biolabs\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Antarctic Phosphatase\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*Ipswich, MA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 T4 DNA Ligase\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Various restriction enzymes\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb360\sa120

\b\fs32 \cf0 2.1.1  Restriction enzymes\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 The following is a list of the restriction enzymes used. All were purchased from NEB:[(i)] 1. 
\f1 SalI
\f0 ; 2. 
\f1 XbaI
\f0 ; 3. 
\f1 NruI
\f0 ; 4. 
\f1 BamHI
\f0 ; 5. 
\f1 StuI
\f0 ; 6. 
\f1 XhoI
\f0 ; 7. 
\f1 ApaI
\f0 ; and 8. 
\f1 KpnI
\f0 .  \
\pard\pardeftab720\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.2: List of PCR Cloning Primers\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Primer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Sequence\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  
\f1 Orai3 start salI
\f0  \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 TGCCGA\cf3 GTCGAC\cf0 ATGAAGGGCGGCGAGGGG
\f0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720

\f1 \cf0 Orai3 end xbaI
\f0  \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 TGCCGATCTAGATCACACAGCCTGCAGCTCCCC
\f0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  
\f1 Stim1 start salI
\f0  \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 TGCCGA\cf3 GTCGAC\cf0 ATGGATGTATGCGTCCGTC
\f0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720

\f1 \cf0 Stim1 end xbaI
\f0  \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 TGCCGATCTAGAGCCTACTTCTTAAGAGGCTTCTT
\f0 \cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb480\qc
\cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.3: List of RT-PCR Primers\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Primer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Sequence\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Size\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 orai3_rtpcr_fwd \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 GAGTGACCACGAGTACCCACC
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 orai3_rtpcr_rev \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 GGGTACCATGATGGCTGTGG
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 -1*508 bp\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  hstim1_end_fwd \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 TTGGATTCTTCCCGTTCTCACAGC
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 hstim1_rev \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 GCCTACTTCTTAAGAGGCTTCTT
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 -1*228 bp\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  rp49-fwd \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 ATCGGTTACGGATCGAACAA
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 rp49-rev \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 GACAATCTCCTTGCGCTTCT
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 -1*165 bp\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  HygBP3 \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 CCTGAACTCACCGCGACGTCTGTCG
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 HygBP4 \cell 
\pard\intbl\itap1\pardeftab720

\f1 \cf0 AGGCAGGTCTTGCAACGTGACACC
\f0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 -1*303 bp\cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb360\sa120

\b\fs32 \cf0 2.1.2  Primers\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 All primers were purchased from Integrated DNA Technologies (Coralville, IA).\
\pard\pardeftab720\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.4: List of Cell Culture Reagents\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Manufacturer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Item\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Location\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Atlanta Biologicals\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Fetal Bovine Serum - catalog no. S11050\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Lawrenceville, GA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Lonza\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Schneider\'92s Drosophila Medium\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Walkersville, MD\cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb360\sa120

\b\fs32 \cf0 2.1.3  
\i Drosophila
\i0  resources\
\pard\pardeftab720\sb60\qj

\i\b0\fs24 \cf0 Drosophila
\i0  Schneider line 2 (S2) cells, the 
\f1 pucHygroMT
\f0  plasmid and the 
\f1 puc18-actgfp
\f0  plasmid were all purchased from the Drosophila Genomics Resource Center (Bloomington, IN).\
\pard\pardeftab720\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.5: List of Chemical Reagents\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Manufacturer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Item\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Location\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Acros Organics\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Ethylene Glycol Tetraacetic Acid (EGTA)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 NJ\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 4-(2-hydroxyethyl)-1-piperazineethanesulfonic\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 acid (HEPES)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 HEPES Sodium Salt (HEPES-Na)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Paraformaldehyde 96%\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Sodium Chloride (NaCl)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Fisher Scientific\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Cupric Sulfate Pentahydrate (CuSO
\f2 \uc0\u8901 
\f0 5HO)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Fair Lawn, NJ\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Dimethyl Sulfoxide (DMSO)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 D-glucose\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Hydrochloric Acid (HCl) 10N\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Potassium Chloride (KCl)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Sodium Hydroxide (NaOH) 10N\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Invitrogen\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Fura-2 AM\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Carlsbad, CA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Mirus Bio LLC\cell 
\pard\intbl\itap1\pardeftab720

\i \cf0 Trans
\i0 IT
\fs20 \up8 \'ae
\fs24 \up0 -2020\'a0Transfection Reagent\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Madison, WI\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*MP Biomedicals\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Agar\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*Solon, OH\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Probenecid\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 1*Sigma-Aldrich\cell 
\pard\intbl\itap1\pardeftab720
\cf0 2-Aminoethyl diphenylborinate (2-APB)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 1*St. Louis, MO\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Cyclopiazonic Acid (CPA)\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Pluronic
\fs20 \up8 \'ae
\fs24 \up0  F-127\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Fluka Analytical 1.0 M CaCl\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 Fluka Analytical 1.0 M MgCl\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb480\qc
\cf0  \
\pard\pardeftab720\sb120\sa120
\cf0 Table 2.6: List of Instruments\
\pard\pardeftab720\qj
\cf0 1whiteblack! 15 \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Manufacturer\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Item\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Location\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Applied Biosystems\cell 
\pard\intbl\itap1\pardeftab720
\cf0 2720 Thermal Cycler\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Foster City, CA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Denver Instruments\cell 
\pard\intbl\itap1\pardeftab720
\cf0 UltraBasic pH/mV meter\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Bohemia, NY\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Sutter Instrument\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Lambda 10-B\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Novato, CA\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Thermo Fisher Scientific\cell 
\pard\intbl\itap1\pardeftab720
\cf0 NanoDrop ND 1000\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Wilmington, DE\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 Intracellular Imaging Inc.\cell 
\pard\intbl\itap1\pardeftab720
\cf0 175 W Xenon Lamp\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Cincinnati, OH\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 B & B Microscopes, Ltd.\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Olympus CKX41 Inverted Microscope\cell 
\pard\intbl\itap1\pardeftab720
\cf0 Pittsburgh, PA\cell \lastrow\row
\pard\pardeftab720\qj
\cf0  \
\pard\pardeftab720\sb480\sa120

\b\fs32 \cf0 2.2  Methods\
\pard\pardeftab720\sb180\sa120
\cf0 2.2.1  Maintenance of cell lines\
\pard\pardeftab720\sb60\qj

\i\b0\fs24 \cf0 Drosophila
\i0  S2 cells were cultured at 27  in Schneider\'92s 
\i Drosophila
\i0  medium supplemented with 10% fetal bovine serum (FBS). \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 2.2.2  Creation of 
\i Drosophila
\i0  expression constructs\
\pard\pardeftab720\sb180\sa120

\fs24 \cf0 Molecular Cloning\
\pard\pardeftab720\sb60\qj

\b0 \cf0 We needed to express mammalian genes (Orai3, Stim1) on a 
\i Drosophila
\i0  background, a process which required some molecular biology finesse. We chose to accomplish this by transferring these genes to a 
\i Drosophila
\i0  vector. We selected the 
\f1 pucHygroMT
\f0  plasmid as our vector, whereas Orai3 and Stim1 were the kind gifts of Dr. Stefan Feske, NYU School of Medicine.\
\pard\pardeftab720\sb60\qj

\f1 \cf0 pucHygroMT
\f0  contains a metallothionein promoter before the multiple cloning site (MCS), allowing for the induction of expression of genes placed in the MCS. It also provides the necessary genes for driving constitutive hygromycin B resistance. Also, 
\f1 pucHygroMT
\f0  was available at a significantly lower cost compared to alternative vectors from commercial suppliers. Additionally, the use of this vector for induction and creation of stable lines has previously been documented (12). \
\pard\pardeftab720\fi40\qj
\cf0 Our genes of interest \'96 mammalian Orai3 and Stim1 \'96 were placed in the 
\f1 pucHygroMT
\f0  plasmid using 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  sites. The inserts for our genes of interest were created by polymerase chain reaction (PCR) using the primers listed in Table\'a02.2. The 
\f1 Orai3 start salI
\f0  and 
\f1 Orai3 end xbaI
\f0  primers were used for the Orai3 insert. The Stim1 insert was generated using 
\f1 Stim1 start salI
\f0  and 
\f1 Stim1 end xbaI
\f0  primers. The forward primer for each insert contained a 
\f1 SalI
\f0  restriction site (
\f3\b GTCGAC
\f0\b0 ), preceded by an 
\f1 NruI
\f0  restriction site (
\f3\b TGCCGA
\f0\b0 ). The reverse primer for each insert had an 
\f1 XbaI
\f0  restriction site (
\f3\b TCTAGA
\f0\b0 ), preceded by an 
\f1 NruI
\f0  restriction site (
\f3\b TGCCGA
\f0\b0 ). \
Each PCR reaction consisted of: [(i)] 1. 1X Easy-A reaction buffer; 2. .2 mM dNTPs; 3. 2 \uc0\u956 M forward; and 4. 2 \u956 M reverse primers; 5. 2 \u956 L Easy-A PCR enzyme; 6. 50-100 ng of template DNA; and 7. nuclease-free water up to 100 \u956 L. \
The PCR reaction thermocycler parameters for each amplicon were as follows: \
\pard\pardeftab720\fi40\qj

\i\b \cf0 Orai3
\i0\b0 , [(i)] 1. an initial denaturation step at 95  for 3 minutes; 2. 27 cycles of denaturation at 95  for 40 seconds, followed by annealing at 65  for 30 seconds, then extension at 72  for 1 minute; and 3. a final extension of 72  for 7 minutes. \

\i\b Stim1
\i0\b0 , [(i)] 1. an initial denaturation step at 95  for 3 minutes; 2. 27 cycles of denaturation at 95  for 40 seconds, followed by an annealing step at 65  for 30 seconds, then extension at 72  for 130 seconds; and 3. a final extension of 72  for 7 minutes were performed. \
After the PCR reactions were completed, the amplicons were digested with 
\f1 SalI
\f0  and 
\f1 XbaI
\f0 , then ligated into a similarly digested 
\f1 pucHygroMT
\f0  vector (see details below).\
\pard\pardeftab720\sb120\sa120

\b \cf0 Engineering 
\i Drosophila
\i0  vector contructs\
\pard\pardeftab720\sb60\qj

\b0 \cf0 Each PCR product and the 
\f1 pucHygroMT
\f0  vector were digested by 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  restriction enzymes. The vector digest was followed by treatment with Antarctic Phosphatase, according to the manufacturer\'92s instructions. Phosphatase treatment removed the 5 phosphate group at the end of the digested vector DNA. This helped prevent spontaneous recircularization and increased the amount of vector available to ligate with the insert. The digested vector and digested PCR amplicons were run on a 0.8% 1X TAE agarose gel for 90 minutes at 80 V. Following electrophoresis, the DNA band was excised under UV illumination. The vector and insert DNA were then purified using the Agarose GelExtract Mini kit. After purifying the DNA, a ligation reaction was performed with T4 DNA ligase following the manufacturer\'92s specifications. The insert to vector ratios in the ligations were 9:1 (by volume). After a 15 minute incubation at 25 , the ligation mixture was used to transform DH10\uc0\u946  competent cells. The ligated constructs were renamed to indicate the inserts, thus 
\f1 \ul pucHygMT-Orai3
\f0 \ulnone  contained Orai3, while 
\f1 \ul pucHygMT-STIM1
\f0 \ulnone  contained Stim1.\
\pard\pardeftab720\sb120\sa120

\b \cf0 Transformation of ligated DNA\
\pard\pardeftab720\sb60\qj

\b0 \cf0 A 15 ml round-bottom tube was chilled on ice, prior to addition of 100 \uc0\u956 L thawed DH10\u946  cells. Subsequently, 4 \u956 L of the ligation mixture was added, mixed gently by flicking, then chilled on ice for 30 minutes. Next, the tube was incubated at 42  for 45 seconds, then quickly transferred to ice for 90 seconds. After this, 900 \u956 L of SOC medium was added. A one hour incubation at 37  followed, with shaking at 250 RPM. 200 \u956 L of this transformation mixture was plated on LB-Agar plates containing 100 \u956 g/mL of the antibiotic ampicillin (+Amp). The resulting LB-Agar +Amp plates were placed in an incubator at 37  overnight. After 16-18 hrs the plates were transferred to 4 . Individual colonies from these plates were used to start miniprep cultures and obtain plasmid DNA.\
\pard\pardeftab720\sb120\sa120

\b \cf0 Minipreparation of plasmid DNA\
\pard\pardeftab720\sb60\qj

\b0 \cf0 Single colonies were picked and added to 4 ml of LB supplemented with 100 \uc0\u956 g/mL of ampicillin. This mixture was placed in an incubator at 37 , with shaking at 250 rpm, for 16-18 hours. A miniprep procedure was performed according to the instructions provided with the Pureyield
\fs20 \up8 \'99
\fs24 \up0  Plasmid Miniprep System. DNA concentrations were estimated using a NanoDrop ND 1000 spectrophotometer.\
\pard\pardeftab720\sb120\sa120

\b \cf0 Maxipreparation of plasmid DNA\
\pard\pardeftab720\sb60\qj

\b0 \cf0 A maxiprep culture consisting of 100 ml of LB, supplemented with 100 \uc0\u956 g/ml of ampicillin was started, using 100 \u956 L of the miniprep culture. This mixture was placed in an incubator at 37 , with shaking at 250 rpm, for 16-18 hours. A maxiprep procedure was performed according to the protocol of the PerfectPrep EndoFree Plasmid Maxi kit. DNA concentrations were estimated using a NanoDrop ND 1000 spectrophotometer.\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 2.2.3  Transfection of S2 cells\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 S2 cells were transfected with 
\i Trans
\i0 IT
\fs20 \up8 \'ae
\fs24 \up0 -2020\'a0transfection reagent according to the manufacturer\'92s instructions. Briefly, one day prior to transfection, S2 cells were plated at 80% confluency in a 6-well tissue culture plate. 
\f1 pucHygMT-Orai3
\f0  vector transfections were done with 1 \uc0\u956 g of DNA per well. Transfections involving 
\f1 pucHygMT-STIM1
\f0  used 2 \uc0\u956 g of DNA per well. 
\f1 pucHygMT-STIM1
\f0  and 
\f1 pucHygMT-Orai3
\f0  co-transfections were performed at a 2:1 ratio (Stim1:Orai3). \
\pard\pardeftab720\fi40\qj
\cf0 As a positive control for transfection, 0.25 \uc0\u956 g of the green fluorescent protein (GFP) vector 
\f1 puc18-act-gfp
\f0 , was co-transfected with the above constructs. A ratio of 3 \uc0\u956 L of 
\i Trans
\i0 IT
\fs20 \up8 \'ae
\fs24 \up0 -2020\'a0was used per 1 \uc0\u956 g of maxiprepped DNA.\
\pard\pardeftab720\sb120\sa120

\b \cf0 Induction of transfected S2 cells with CuSO\
\pard\pardeftab720\sb60\qj

\i\b0 \cf0 Drosophila
\i0  S2 cells were induced by the addition of 750 \uc0\u956 M CuSO one or two days post-transfection.\
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 2.2.4  RT-PCR and cDNA synthesis\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Total RNA was isolated from transfected S2 cells, two days post-induction, using TRI reagent
\fs20 \up8 \'ae
\fs24 \up0  as per the manufacturer\'92s instructions. Traces of contaminating DNA were removed using RNase-free DNase I. For each \uc0\u956 g of RNA, 1 \u956 L of DNase I was added. First strand cDNA synthesis was performed using the MMLV reverse transcriptase (RT). Briefly, 1 \u956 g of mRNA was reverse transcribed into cDNA during a 30 minute incubation at 45 . This cDNA served as the template for successive PCR reactions. \
\pard\pardeftab720\fi40\qj
\cf0 The RT reaction mixture contained: [(i)] 1. 1X MMLV buffer; 2. .8 mM dNTPs; 3. 1 \uc0\u956 g of template RNA; 4. 2 \u956 L MMLV RT; and 5. nuclease-free water up to 50 \u956 L. RT reactions were also performed on samples with the RT omitted \'96 to determine whether any contaminating DNA was still present. \
PCR reactions were performed in a 2720 Thermal Cycler. The 
\i Drosophila
\i0  housekeeping gene, ribosomal protein 49 (rp49), was used as a positive control to determine whether cDNA was made in the preceding RT reaction (7, 23).\
Each PCR reaction contained: [(i)] 1. 1x Easy-A reaction buffer; 2. .3 mM dNTPs; 3. 1 \uc0\u956 M forward; and 4. 1 \u956 M reverse primers; 5. .5 \u956 L Easy-A PCR enzyme; 6. 5 \u956 L of cDNA template from the (no-)RT reaction; and 7. nuclease-free water up to 50 \u956 L. The sequences of these RT-PCR primers (23, 25, 43), and expected band sizes are given in Table 2.3. \
The PCR reaction parameters are as follows: \
\pard\pardeftab720\fi40\qj

\i\b \cf0 Orai3 and Stim1
\i0\b0 , [(i)] 1. an initial denaturation step at 95  for 3 minutes; 2. 30 cycles of denaturation at 95  for 30 seconds, then annealing at 55  for 30 seconds, then extension at 72  for 1 minute; and 3. a final extension of 72  for 10 minutes was performed. \

\i\b HygBP
\i0\b0 , [(i)] 1. an initial denaturation step at 95  for 3 minutes; 2. 30 cycles of denaturation at 95  for 30 seconds, then annealing at 65  for 30 seconds, then extension at 72  for 30 seconds; and 3. a final extension of 72  for 10 minutes was performed. \

\i\b rp49
\i0\b0 , [(i)] 1. an initial denaturation step at 94  for 3 minutes; 2. 30 cycles of denaturation at 94  for 45 seconds, then annealing at 50  for 1 minute, then extension at 72  for 1 minute 30 seconds; and 3. a final extension of 72  for 7 minutes was performed. \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 2.2.5  Ca imaging experiments\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 Two primary solutions were used for the Ca imaging experiments. The first, designated 
\b 2 Ca
\b0 , contained (in mM): 2 CaCl, 4 MgCl, 150 NaCl, 5 KCl, 10 HEPES and, 10 D-glucose at pH 7.2 (48). The second solution 
\b 1 EGTA
\b0 , contained (in mM), 1 EGTA, 6 MgCl, 150 NaCl, 5 KCl, 10 HEPES and, 10 D-glucose at pH 7.2 (48). The dye loading solution referred to below was comprised of 2 Ca, 0.02% Pluronic F-127, 2.5 mM probenecid and 4 \uc0\u956 M Fura2-AM. \
\pard\pardeftab720\fi40\qj
\cf0 Cytosolic Ca signals were measured in the following way: S2 cells, cultured at 27 , were placed in 35 mm glass-bottom chambers made by J. Ashot Kozak, Ph. D. After 30 minutes at room temperature, the old medium was removed, and the cells washed in 1X DPBS twice. After the wash, the dye-loading solution was added to the cells and they were incubated at room temperature for 45 minutes. The cells were then washed twice with the 2 Ca solution, and used for imaging. \
Ca imaging was performed on the stage of an Olympus CKX41 inverted microscope, attached to a Dell Optiplex 745C computer. Cells were perfused at a rate of approximately 4 mL/min using the solutions indicated in the figures below. Loaded cells were exposed to light of 340 nm and 380 nm wavelengths, and emitted light at 510 nm was recorded. The UV light source was a 175 W Xenon arc lamp. The wavelengths were selected using filters in the Lambda 10-B SmartShutter which was controlled by the InCytIM 2 software (Intracellular Imaging, Cincinnati, OH). \
\pard\pardeftab720\sb120\sa120

\b \cf0 Selection of data for analysis\
\pard\pardeftab720\sb60\qj

\b0 \cf0 The traces were selected based on the following criteria: [(i)] 1. there was a visible response to CPA introduction; 2. the initial perfusion with 2 Ca was relatively stable over time; 3. the absolute values of the measurements at 340 nm and 380 nm were \uc0\u8805  40 during initial perfusion with 2 Ca; and 4. the 340 nm and 380 nm recordings mirrored each other as time progressed. \
\pard\pardeftab720\sb120\sa120

\b \cf0 Statistical analysis of imaging experiment data\
\pard\pardeftab720\sb60\qj

\b0 \cf0 Error bars shown on the traces depict the standard error of the mean. Area under the curve analysis was performed using Origin 8 software. Statistical analysis of the area under the curve data was performed using one way ANOVA with SAS software. Differences were considered significant if p values were < 0.05. The p values of < 0.001 were denoted by the *** characters.\
\page \pard\pardeftab720\sb240\sa120

\b\fs40 \cf0 Chapter 3\
Results\
\pard\pardeftab720\sb240\qj

\f1\b0\fs24 \cf0 ATGAAGGGCGGCGAGGGGGACGCGGGCGAGCAGGCCCCGCTGAACCCTGAGGGCGAGAGC\
\pard\pardeftab720\fi40\qj
\cf0 CCTGCAGGCTCGGCCACGTACCGGGAGTTCGTGCACCGCGGCTACCTGGACCTCATGGGG\
GCCAGTCAGCACTCGCTGCGGGCGCTCAGCTGGCGCCGCCTCTACCTCAGCCGGGCCAAG\
CTCAAAGCTTCCAGCCGCACGTCTGCCTTGCTCTCGGGCTTCGCCATGGTGGCCATGGTG\
GAGGTGCAGCTGGAGAGTGACCACGAGTACCCACCAGGCCTGCTGGTGGCCTTCAGTGCC\
TGCACCACCGTGCTGGTGGCTGTGCACCTCTTTGCACTCATGGTCTCCACGTGTCTGCTG\
CCCCACATTGAAGCTGTGAGCAACATCCACAACCTCAACTCTGTCCACCAGTCGCCACAC\
CAGAGACTGCACCGCTACGTGGAGCTGGCCTGGGGCTTCTCCACTGCCCTGGGCACCTTT\
CTCTTCCTTGCTGAAGTTGTCCTGGTTGGTTGGGTCAAGTTTGTGCCCATTGGGGCTCCC\
TTGGACACACCGACCCCCATGGTGCCCACATCCCGGGTGCCCGGGACTCTGGCACCAGTG\
GCTACCTCCCTTAGTCCAGCTTCCAATCTCCCACGGTCCTCTGCGTCTGCAGCACCGTCC\
CAGGCTGAGCCAGCCTGCCCACCCCGGCAAGCCTGTGGTGGTGGTGGGGCCCATGGGCCA\
GGCTGGCAAGCAGCCATGGCCTCCACAGCCATCATGGTACCCGTGGGGCTCGTGTTTGTG\
GCCTTTGCCCTGCATTTCTACCGCTCCTTGGTGGCACACAAGACAGACCGCTACAAGCAG\
\pard\pardeftab720\sb240\qj
\cf0 GAACTAGAGGAACTGAATCGCCTGCAGGGGGAGCTGCAGGCTGTGTGA
\f0 \
\pard\pardeftab720\fi40\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \'ef\'bf\'bc\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.1: 
\b Map of the 
\f3 pucHygroMT
\f0  vector.
\b0  
\f1 pucHygroMT
\f0  contains 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  sites which were used to insert both Orai3 and STIM1 into the MCS.\
\pard\pardeftab720\sb240\qj
\cf0 Figure\'a03.1 shows a schematic of the 
\f1 pucHygroMT
\f0  vector, with possible sites of insertion in the MCS. The 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  sites were used to place both Orai3 and STIM1 under control of the metallothionien promoter. The 
\f1 XhoI
\f0  and 
\f1 BamHI
\f0  sites were also used, in conjunction with restriction sites specific to the inserts, to confirm the presence of the inserts within the vector. The HygBP primers (see table\'a02.3) targeted the hygromycin b resistance gene present in 
\f1 pucHygroMT
\f0 . \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 3.1  Creating inducible vectors\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 \'a0\
\pard\pardeftab720\sb240\qc

\fs12 \cf0 1whiteblack! 15 \
\pard\pardeftab720\sb3300\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\'a0\'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \lastrow\row
\pard\pardeftab720\sb240\qc
\cf0   \
\pard\pardeftab720\sb120\qc

\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 [Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.2: 
\b Restriction digests confirm the insertion of Orai3 into puc-HygroMT
\b0 .\
\pard\pardeftab720\sb120\sa120

\b \cf0 Lane M
\b0  shows the DNA ladder, with the sizes of the corresponding bands to their left. 
\b Lane 1
\b0  shows a 
\f1 SalI
\f0 +
\f1 XbaI
\f0  double digest of both 
\f1 pucHygroMT
\f0  and the Orai3 PCR amplicon. The double digested 
\f1 pucHygroMT
\f0 , 
\f4 \uc0\u8764 
\f0 7000 bp in size, is the higher of the two bands. Orai3, which is 894 bp in size, is the lower band. 
\b Lane 2
\b0  shows the result of a 
\f1 BamHI
\f0 +
\f1 XhoI
\f0  double digest of 
\f1 pucHygMT-Orai3
\f0 . The complete vector is 
\f4 \uc0\u8764 
\f0 7888 bp. From a 931 bp fragment and the remainder of the vector, 
\f4 \uc0\u8764 
\f0 6957 bp. 
\b Lane 3
\b0  shows the result of a 
\f1 KpnI
\f0 +
\f1 XhoI
\f0  double digest of 
\f1 pucHygMT-Orai3
\f0 . This gives a 796 bp band and a remaining 
\f4 \uc0\u8764 
\f0 7092 bp band. 
\b Lane 4
\b0  shows the undigested 
\f1 pucHygMT-Orai3
\f0 . This yields supercoiled and open circular vector DNA species. \
\pard\pardeftab720\sb240\qj
\cf0 After ligating the 
\f1 pucHygroMT
\f0  and inserts and transforming the products, the DNA obtained from the maxipreparation was digested to confirm that the desired constructs were generated. Figure\'a03.2 shows the results of digesting the 
\f1 pucHygMT-Orai3
\f0  construct after electrophoresis on a 0.8% 1X TAE gel. The marker lane, shows DNA bands of known sizes, used for estimating the sizes of bands in subsequent lanes. In lane 1 shows the sizes obtained when both 
\f1 pucHygroMT
\f0  vector and the Orai3 PCR amplicon are digested with 
\f1 SalI
\f0 +
\f1 XbaI
\f0 . The 
\f1 pucHygroMT
\f0  vector map gives its size as 7000 bp. Based on comparison with the DNA marker, double digested 
\f1 pucHygroMT
\f0  is estimated to be 
\f4 \uc0\u8764 
\f0 7000 bp. This implies a difference of only a few bases between the 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  sites in the MCS. The Orai3 PCR amplicon, after digestion, is 894 bp. This comes from the 888 bp size of Orai3, plus the bases for the digested 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  restriction sites. A reasonable estimate for the size of 
\f1 pucHygMT-Orai3
\f0  would be 7888 bp. This comes from the 
\f4 \uc0\u8764 
\f0 7000 bp size of the digested vector and the 888 bp Orai3 insert. The restriction sites in the Orai3 amplicon are not added to the total, as they are already accounted for in the vector. \
\pard\pardeftab720\fi40\qj
\cf0 We tested whether insertion of 
\f1 pucHygMT-Orai3
\f0  was successful by doing restriction digests and comparing the estimated size of the obtained bands, with the size that was expected. The double digest of 
\f1 pucHygMT-Orai3
\f0  with 
\f1 BamHI
\f0  and 
\f1 XhoI
\f0  is shown in lane 2 of figure\'a03.2. Digestion with these enzymes is expected to yield a 931 bp and 
\f4 \uc0\u8764 
\f0 6957 bp bands. Observed bands are approximately this size, based on comparison with our DNA marker, and the digested DNA in lane 1. Our 931 bp band is at roughly the same point as the 894 bp Orai3 insert, and both are just below the 1000 bp marker.\
For the 
\f1 pucHygMT-Orai3
\f0  construct we tested whether our insert was placed in the correct orientation by digesting with an enzyme which cut the vector, and an enzyme which cut the insert . Lane 3 of figure\'a03.2 shows the result of a 
\f1 KpnI
\f0  and 
\f1 XhoI
\f0  double digest of 
\f1 pucHygMT-Orai3
\f0 . This time we see the 
\f4 \uc0\u8764 
\f0 7888 bp vector producing the expected 796 bp and 
\f4 \uc0\u8764 
\f0 7092 bp bands. \
The last lane shows us what the undigested 
\f1 pucHygMT-Orai3
\f0  looks like. We are therefore able to observe the supercoiled and open circular DNA species of the vector in lane 4. Taken together, figure\'a03.2 shows that Orai3 was inserted into 
\f1 pucHygroMT
\f0 , and more importantly, in the correct direction. Further confirmation was obtained after sequencing 
\f1 pucHygMT-Orai3
\f0 .\
\'a0\
\pard\pardeftab720\sb240\qc

\fs12 \cf0 1whiteblack! 15 \
\pard\pardeftab720\sb2600\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  \'a0\'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1728
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx3456
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5184
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx6912
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \lastrow\row
\pard\pardeftab720\sb240\qc
\cf0   \
\pard\pardeftab720\sb120\qc

\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 [Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.3: 
\b Restriction digests confirm the insertion of STIM1 into puc-HygroMT
\b0 . \
\pard\pardeftab720\sb120\sa120

\b \cf0 Lane 1
\b0  shows a 
\f1 StuI
\f0 +
\f1 XhoI
\f0  digest of 
\f1 pucHygMT-STIM1
\f0 . The 
\f4 \uc0\u8764 
\f0 7000 bp 
\f1 pucHygroMT
\f0  and 2060 bp STIM1 create a 
\f4 \uc0\u8764 
\f0 9060 bp construct. 
\f1 StuI
\f0 +
\f1 XhoI
\f0  digestion gives 1016 bp and 
\f4 \uc0\u8764 
\f0 8044 bp bands. 
\b Lane 2
\b0  shows the result of a 
\f1 BamHI
\f0 +
\f1 StuI
\f0  digest of 
\f1 pucHygMT-STIM1
\f0 . This yields 1087 bp and 
\f4 \uc0\u8764 
\f0 7973 bp bands. 
\b Lane 3
\b0  is the 
\f1 SalI
\f0 +
\f1 XbaI
\f0  digest of 
\f1 pucHygMT-STIM1
\f0 . A 2066 bp band and a 
\f4 \uc0\u8764 
\f0 6994 bp band are the result. Linearized 
\f1 pucHygMT-STIM1
\f0 , at 
\f4 \uc0\u8764 
\f0 9060 bp is also present. 
\b Lane 4
\b0  shows the undigested 
\f1 pucHygMT-STIM1
\f0 . We see supercoiled and open circular vector DNA species here. \
\pard\pardeftab720\sb240\qj
\cf0 We again confirmed successful creation of our STIM1 construct with restriction digests. Figure\'a03.3 shows the results of 
\f1 pucHygMT-STIM1
\f0  digests after electrophoresis on a 0.8% 1X TAE agarose gel. Again, the marker lane shows DNA of known sizes, and is used to estimate the band size in subsequent lanes. \
\pard\pardeftab720\fi40\qj
\cf0 In lane 1 the 
\f1 StuI
\f0 +
\f1 XhoI
\f0  digest provides confirmation of STIM1 insertion into 
\f1 pucHygMT-STIM1
\f0 . The 
\f1 StuI
\f0  site is specific to STIM1 while the 
\f1 XhoI
\f0  site is specific to the vector. Two bands, sized at approximately 8044 bp and 1016 bp were expected and obtained. In lane 2 the 
\f1 StuI
\f0  and 
\f1 BamHI
\f0  digest provide additional confirmation of properly inserted STIM1. In this digest reaction 
\f1 BamHI
\f0  is present only in the vector. This digest yields the anticipated bands at approximately 7973 bp and 1087 bp. Insertion of STIM1 in the reverse direction would have yielded different sizes. These results confirm that our insert is present, and further, in the desired orientation. We can see that our gel is also able to resolve the difference between 1016 bp and 1087 bp (though not between 1016 bp and 1000 bp) providing further confirmation that our inserts are oriented correctly. \
The 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  digest in lane 3 further supports our claims. The 2066 bp STIM1 and 
\f4 \uc0\u8764 
\f0 6994 bp vector fragments are visible. A third band, the linearized 
\f1 pucHygMT-STIM1
\f0  vector, is also visible at 
\f4 \uc0\u8764 
\f0 9060 bp. That the 
\f4 \uc0\u8764 
\f0 8 kb (7973 bp) band in lane 2, fits between our expected 
\f4 \uc0\u8764 
\f0 7 kb and 
\f4 \uc0\u8764 
\f0 9 kb bands in lane 3 also supports our assertion that 
\f1 pucHygMT-STIM1
\f0  contains STIM1 in the desired orientation. Lane 4 shows undigested 
\f1 pucHygMT-STIM1
\f0  with supercoiled and open circular DNA species. \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 3.2  Demonstrating inducible expression\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 \'a0 \
\pard\pardeftab720\sb240\qc

\fs12 \cf0 1whiteblack! 15 \
\pard\pardeftab720\sb2800\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \'a0\'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell \lastrow\row
\pard\pardeftab720\sb240\qc
\cf0   \
\pard\pardeftab720\sb120\qc

\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 [Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.4: 
\b Orai3 expression is inducible in 
\i Drosophila
\i0  S2 cells using 750 \uc0\u956 M CuSO
\b0 . (
\b A
\b0 ) In 
\b lanes 1-5
\b0  the Orai3 RT-PCR primer pair are used (see table\'a02.3) 
\b Lane 1
\b0  shows the band from a positive control PCR reaction. Orai3 DNA is used as the template. 
\b Lanes 2-5
\b0  show RT-PCRs using RNA from isolated 
\f1 pucHygMT-Orai3
\f0  transfected S2 cells. 
\b Lanes 2-3
\b0 : S2 cells were induced with 750 \uc0\u956 M CuSO. 508 bp band only present when RT is added. 
\b Lane 4-5
\b0 : S2 cells were not induced with CuSO. No band present after RT-PCR. (
\b B
\b0 ) RT-PCR of the same samples as in A, using rp49 primers. We see rp49 bands at 165 bp only in the lanes where RT was added to the reaction. (
\b C
\b0 ) RT-PCR of the same samples as in A, with HygBP primers. HygBP bands at 303 bp are seen only in the lanes where RT was added to the reaction. \
\pard\pardeftab720\sb240\qj
\cf0 The RT-PCR reactions in figure\'a03.4 were performed on RNA collected from 
\f1 pucHygMT-Orai3
\f0 -transfected (Orai3+) S2 cells. Figure\'a03.4 shows that induction of Orai3 RNA in these S2 cells is successful. Panel A shows that DNA positive control and RNA induction bands are the same size, 508 bp. No observable band is present when CuSO is not added to Orai3+ S2 cells in lanes 4 and 5. This suggests negligible levels of Orai3 gene expression when under control of the metallothionein promoter.\
\pard\pardeftab720\fi40\qj
\cf0 Panels B shows rp49 RNA present in equal amounts for Orai3+ cells with or without CuSO. The rp49 RT-PCR looks for expression of the housekeeping gene rp49, and serves as a positive control for RT-PCR from Orai3+ S2s. Panel C shows more HygBP RNA in Orai3+ S2 cells with no CuSO added. This is suggestive of a pipeting error occurring. Panels A, B and C all showed no evidence of DNA contamination of these RT-PCR reactions, as lanes where RT was omitted (indicated in table) did not produce bands. \
Some lower bands were observed in all the RT-PCR reactions and are likely the result of primer-dimer products. Such phenomenon has been documented elsewhere (8). \
\pard\pardeftab720\sb240\qc

\fs12 \cf0 1whiteblack! 15 \
\pard\pardeftab720\sb3200\qc
\cf0 \

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrt\brdrnil \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0  \'a0\'a0\'a0\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell \row

\itap1\trowd \taflags1 \trgaph108\trleft-108 \trbrdrl\brdrnil \trbrdrt\brdrnil \trbrdrr\brdrnil 
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx1440
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx2880
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx4320
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx5760
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx7200
\clvertalc \clshdrawnil \clbrdrt\brdrs\brdrw20\brdrcf2 \clbrdrl\brdrs\brdrw20\brdrcf2 \clbrdrb\brdrs\brdrw20\brdrcf2 \clbrdrr\brdrs\brdrw20\brdrcf2 \clpadl100 \clpadr100 \gaph\cellx8640
\pard\intbl\itap1\pardeftab720
\cf0 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 \uc0\u8722 \cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell 
\pard\intbl\itap1\pardeftab720
\cf0 +\cell \lastrow\row
\pard\pardeftab720\sb240\qc
\cf0   \
\pard\pardeftab720\sb120\qc

\fs24 \cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 [Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.5: 
\b STIM1 expression is inducible in 
\i Drosophila
\i0  S2 cells using 750 \uc0\u956 M CuSO
\b0  (
\b A
\b0 ) In 
\b lanes 1-5
\b0  the STIM1 RT-PCR primer pair are used (see table\'a02.3). 
\b Lane 1
\b0  shows the positive control PCR band using STIM1 template DNA. 
\b Lanes 2-5
\b0  show RT-PCRs using RNA from isolated 
\f1 pucHygMT-STIM1
\f0  transfected S2 cells. 
\b Lanes 2-3
\b0 : S2 cells induced with 750 \uc0\u956 M CuSO. 228 bp band present only when RT added. 
\b Lanes 4-5
\b0 : S2 cells not induced with CuSO. Faint band at 228 bp seen when RT added. (
\b B
\b0 ) RT-PCR using rp49 primers yields bands only in the lanes with RT added. (
\b C
\b0 ) RT-PCR using HygBP primers yields bands only in the lanes where RT added. \
\pard\pardeftab720\sb240\qj
\cf0 The RT-PCR reactions in figure\'a03.5 were performed on RNA collected from 
\f1 pucHygMT-STIM1
\f0 -transfected (STIM1+) S2 cells. Figure\'a03.5 shows that induction of STIM1 RNA in these S2 cells is successful. Panel A shows that DNA positive control and RNA induction bands are the same size. Both show up in the region where we would expect to see a 228 bp band. A faint band in the uninduced STIM1 RT-PCR reaction is visible in lane 4 of panel A. This suggests a basal level of expression for STIM1 when under the control of the metallothionein promoter.\
\pard\pardeftab720\fi40\qj
\cf0 Panels B and C show that more RNA was present in RT-PCR reactions of uninduced STIM1+ S2 cells, when compared to RNA from CuSO induced STIM1+ S2 cells. This was present in both panels B and C, suggesting an error in estimating the RNA concentration using the NanoDrop spectrophotometer. This adds further support for the successful induction of STIM1 RNA from CuSO induced STIM1+ cells. More RNA was present in the 
\i uninduced
\i0  RT-PCR reactions, yet a much brighter STIM1 band was present in the CuSO induced lane.\
There was no evidence of DNA contamination of the RT-PCR reactions, as lanes without RT, produced no bands. \
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 3.3  Effective measurement of Ca transients\
\pard\pardeftab720\sb300\qc

\b0\fs24 \cf0  \'ef\'bf\'bc \
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.6: 
\b The absence of probenecid results in poor Ca imaging results in S2 cells
\b0 . (
\b A
\b0 ) The ratio of the 340 nm and 380 nm wavelengths of an individual cell during the course of one perfusion experiment where probenecid was omitted from the incubation solution. (
\b B
\b0 ) The individual 340 nm and 380 nm wavelength values, which produced the ratio seen in 
\b A
\b0 .\
\pard\pardeftab720\sb240\qj
\cf0 Figure\'a03.6A shows a recording from an individual S2 cell which was loaded without probenecid present in the dye-loading solution (DLS). Figure\'a03.6B shows the individual 340 and 380 nm wavelength values that produced the trace in 3.6A. Though the trace of the ratio hides it, we see that both wavelengths values start decreasing immediately after the start of the experiment. The decreasing values continues to the end of the experiment. This figure illustrates the leakage of Fura-2 which takes place in S2 cell if probenecid is absent in the DLS. The Ca ratios reported after SOCE, upon reintroduction of 2 Ca is also shown to be low here. This is an artifactual recording caused by less Fura-2 being around to bind to Ca, thereby limiting the amount of Ca which can be measured in the cytosol.\
\pard\pardeftab720\fi40\sb240\qc
\cf0  \'ef\'bf\'bc \
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.7: 
\b The presence of 2.5 mM probenecid results in much improved Ca imaging in S2 cells
\b0 . (
\b A
\b0 ) The ratio of the 340 nm and 380 nm wavelengths of an individual cell during the course of a perfusion experiment where 2.5 mM probenecid was included in the incubation solution. (
\b B
\b0 ) The individual 340 nm and 380 nm wavelength values, which produced the ratio seen in 
\b A
\b0 .\
\pard\pardeftab720\sb240\qj
\cf0 Figure\'a03.7A shows a sample recording from a cell incubated with DLS containing 2.5 mM probenecid. The ratio is robust and provides better resolution than the trace in figure\'a03.6. Figure\'a03.6B gives the individual 340 nm and 380 nm wavelengths which were used to obtain the ratio in 3.6A. We are able to clearly see the reciprocal nature of the 340 nm and 380 nm wavelength values. The steady decline of the values over the course of the experiment is no longer apparent. Probenecid has stopped or greatly slowed leakage of Fura-2 from the cytosol. As a result, we are able to record higher Ca transients as more Fura-2 is available as the experiment proceeds, compared to cells loaded without probenecid. This is readily apparent in the SOCE portion of the trace. \
\pard\pardeftab720\fi40\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0  \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
 \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.8: 
\b Addition of Probenecid improves Ca recordings
\b0 . (
\b A
\b0 ) Recordings taken from a population of cells incubated in dye-loading solution that did not contain probenecid (
\b B
\b0 ) Recordings taken from a population of cells incubated in dye-loading solution that contained 2.5 mM probenecid.\
\pard\pardeftab720\sb240\qj
\cf0 Figure\'a03.8 shows a population of cells loaded without (3.8A) and with (3.8B) probenecid. We are able to observe a larger Ca transient, due to more Fura-2 being available. Also, addition of probenecid results in more cells meeting the selection criteria for data collection. This can be attributed to Fura-2 retention in probenecid treated S2 cells. The result is more dye being available at the start of the experiment, and as it progresses. \
\pard\pardeftab720\fi40\qj
\cf0 Unhealthy cells, cells with damaged or otherwise compromised plasma membranes may also be omitted from the data set in a reliable, unbiased manner after probenecid treatment. Such cells would still display characteristics of cells not treated with probenecid, such as pronounced, constant dye leakage.\
Conditions for selecting data were formulated after looking at the individual 340 nm and 380 nm wavelength values for probenecid treated, and probenecid untreated cells. Three out of six of the cells in figure\'a03.8A, had either 340 nm or 380 nm wavelength values below 40. This led to 40 being used as a cutoff value for selecting data. For the S2 cells selected, both the 340 nm or 380 nm wavelength values stayed at or above 40 during the initial 2 Ca perfusion. This allowed for elimination of cells which were leaky, even after treatment with probenecid which, for reasons explained above, were deemed undesirable.\
\pard\pardeftab720\fi40\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0  \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
 \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.9: 
\b Ca measurements in transfected S2 cells perfused with 2-APB
\b0 . The lines above the trace are labeled with the solutions perfused during those times. 
\b A
\b0 ) Sample trace of mock transfected S2s showing the effect of 2-APB on SOCE. 
\b B
\b0 ) Sample trace of Orai3 transfected S2s showing the effect of 2-APB on SOCE.\
\pard\pardeftab720\sb480\qc
\cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0  \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
 \
[Sorry. Ignored 
\f1 \\begin\{lpic\} ... \\end\{lpic\}
\f0 ]\
\pard\pardeftab720\sb120\sa120
\cf0 Figure : 
\b Ca measurements in transfected S2 cells perfused with 2-APB
\b0 . The lines above the trace are labeled with the solutions perfused during those times. 
\b C
\b0 ) Sample trace of Orai3+STIM1 transfected S2s showing the effect of 2-APB on SOCE. 
\b D
\b0 ) Sample trace of STIM1 transfected S2s showing the effect of 2-APB on SOCE.\
\pard\pardeftab720\sb240\qj
\cf0 The composite in figure\'a03.9 shows representative traces for Ca imaging experiments where S2 cells have been mock transfected or transfected with Orai3, STIM1, or Orai3+STIM1. In figure\'a03.9A we see a sample trace giving the result of an experiment on mock transfected S2s. Initially, the 2 Ca perfusion of these mock transfected S2s is relatively stable. Upon introduction of 20 \uc0\u956 M CPA in 1 EGTA, we observe an increase in the F340/F380 ratio. This indicates an increase in cytosolic free Ca, resulting from leakage of Ca from the ER. This Ca leak achieves a maximum and subsequently declines. The decline phase is indicative of Ca being pumped out of the cell, shuttled to non-ER compartments, such as the mitochondria, or being bound by cytosolic Ca chelators. Transport of Ca to the ER is prevented by CPA, which blocks the necessary SERCA pumps. \
\pard\pardeftab720\fi40\qj
\cf0 After 7 minutes of perfusion in 1 EGTA/20 \uc0\u956 M CPA, Ca is reintroduced with the 2 Ca solution. The mock transfected S2s then undergo SOCE, and a second Ca transient forms at this stage. The maximal Ca entry after 2 Ca reintroduction is greater than maximal Ca release from the ER. The 
\i dOrai
\i0  channels responsible for SOCE in S2 cells are able to open quickly, allowing Ca into the cell shortly after switching to the 2 Ca solution. We eventually begin to see less Ca recorded, which can be attributed to 
\i dOrai
\i0  channels closing, slowing Ca entry.\
After 4 minutes in 2 Ca, 50 \uc0\u956 M 2-APB is added to the perfusion solution. We see for the mock transfected S2 cells, that the gradual decline in Ca measurements becomes sharper, shortly after addition of 2-APB. This is expected as because 2-APB is inhibitory at these concentrations, for 
\i dOrai
\i0 . The decline in Ca readings continue during the 4 minutes that the 50 \uc0\u956 M 2-APB perfusion lasts. \
After 4 minutes in 2 Ca with 50 \uc0\u956 M 2-APB, the perfusion solution is changed to 2 Ca with 200 \u956 M 2-APB. This solution was perfused across the cells for another 4 minutes and then the experiment was stopped. During this time we observe what seems to be a slight increase. The overlap of the error bars along the trace indicate that, while the trend of the trace tends toward an increasing nature, further analysis is required to determine what is happening at this point. In order to address, the question of what happens to the Ca, area under the curve analysis was performed on each 4 minute section after store-depletion occuredfor each transfected group. \
Figure\'a03.9B shows a sample trace of an experiment on Orai3 transfected S2s. The initial and store-depletion phases are similar to those in the mock transfected S2s. 2 Ca reintroduction shows the swift onset of SOCE. The expected increase in Ca after addition of 50 \uc0\u956  2-APB is not seen, however. Addition of 200 \u956 M 2-APB seemed to result in a marginal increase in Ca entry. The Ca content of this 200 \u956 M 2-APB phase was analyzed further and found to not be a significant change from the mock (see figure\'a03.10).\
As no distinct effect of 2-APB was observed in S2s transfected with only Orai3, Orai3+STIM1 transfections were performed. A sample trace for one of these experiments is provided in figure\'a03.9C. The store-depletion and SOCE phases again seem similar to that of the mock and Orai3 transfected cells. When treated with 50 and then 200 \uc0\u956 M 2-APB, no clear trend was visible compared to the mock or Orai3 transfected cells.\
In figure\'a03.9D a similar experiment was performed, but on STIM1 transfected S2s. Here, the store-depletion and SOCE phases after 2 Ca reintroduction are similar to mock and other transfections. Interestingly, addition of 50 \uc0\u956 M 2-APB in the STIM1 only transfected cells, was less effective at slowing Ca entry than in the other transfections. When 200 \u956 M 2-APB was added, a clear increase in the cytosolic Ca was observed.\
\pard\pardeftab720\fi40\sb240\qc
\cf0  \
\pard\pardeftab720\sb120\sa120\qc
\cf0 \'ef\'bf\'bc \
\pard\pardeftab720\sb120\sa120
\cf0 Figure 3.11: 
\b The effect of 2-APB on transfected S2 cells
\b0 .\
\pard\pardeftab720\sb240\qj
\cf0 Figure\'a03.10 shows the results of the One wat ANOVA, The 2 Ca group represents the untreated period of SOCE in the transfection groups. Statistical analysis of the Ca content, using Area under the curve data, showed no significant change in cytosolic Ca for this group. Functional Orai3 Ca channels were expected to increase the levels of cytosolic Ca during SOCE. That this was not observed may be because to the Ca capacity of the cell already being at maximal levels. If the S2 cell is capable of holding a finite amount of Ca, and it had already reached that point, more Ca channels would merely get it to that point faster, but observing further increase in Ca levels would not be expected in this case.\
\pard\pardeftab720\fi40\qj
\cf0 Discussion mock: To determine whether the cell\'92s cytosol was at its maximal Ca carrying capacity, experiments with 2 Ca and ionomycin can be performed. After store depletion with CPA, 2 Ca can be perfusion, followed by a 2 Ca + ionomycin solution. Ionomycin is an ionophore which would raised the 
\b [
\b0 Ca
\b ]
\b0  to that of the external solution. Depending on the result of perfusion with 2 Ca + ionomycin, we could say with certainty whether the maximal Ca carrying capacity of the cytoplasm was reached. If for example, perfusion with ionomycin resulted in higher Ca levels, than was obtained without ionomycin, this would indicate that maximal levels were not obtained. \
The 2 Ca + 50 2-APB experiments did show significant differences in this treatment group. Significant differences existed between Orai3+STIM1 transfected cells and the Orai3 only transfected group. There were also significant differences between STIM1 only transfected cells and Orai3 only transfected cells. For both of the groups described above, the Orai3 only group showed much less cytosolic Ca, which was unexpected. A significant difference was also found between mock transfected and STIM1 transfected cells, with the STIM1 transfected group containing higher levels of cytosolic calcium than the mock transfected group. The significant differences for all of the above was p < 0.0001 at the 0.05 confidence level. \
The 2 Ca + 200 2-APB showed significant differences only between the STIM1 transfected cells and all the other groups. \
\page \pard\pardeftab720\sb240\sa120

\b\fs40 \cf0 Chapter 4\
Discussion\
\pard\pardeftab720\sb240\qj

\b0\fs24 \cf0 By using directional cloning techniques we were able to quickly generate our desired constructs. Restriction digest analysis was used to determine whether Orai3 and STIM1 were inserted into 
\f1 pucHygroMT
\f0  in the intended orientation. The size of the 
\f1 SalI
\f0 +
\f1 XbaI
\f0  digested vector was taken to be quite close to 7000 bp, as no clear band was visible at 100 bp or higher. Given that these sites were in the multiple cloning region, and given the closeness of the sites on the provided map, it is likely that only a few base pairs separated the sites. The original vector map can be seen in the supplemental data.\
\pard\pardeftab720\fi40\qj
\cf0 In figure\'a03.2 
\f1 BamHI
\f0  and 
\f1 XhoI
\f0  were used to digest 
\f1 pucHygMT-Orai3
\f0  and determine the insert size. In the absence of an insert, a sole 
\f4 \uc0\u8764 
\f0 7000 bp would be observable on the gel. The presence of the 
\f4 \uc0\u8764 
\f0 6957 bp and 931 bp bands indicated that Orai3 insertion was successful.\
\pard\pardeftab720\fi40\qj

\f1 \cf0 BamHI
\f0  and 
\f1 XhoI
\f0  were selected because 
\f1 SalI
\f0  and 
\f1 XbaI
\f0  digestion did not produce the expected bands. Further analysis uncovered that this was due to the 
\f1 XbaI
\f0  site being blocked as a result of a dam methylation. The 
\f1 TGA
\f0  stop codon of Orai3 combined with the 
\f1 TCTAGA
\f0  
\f1 XbaI
\f0  restriction site, introduced a 
\f1 GATC
\f0  dam methylation site. The result was a linearized 
\f1 pucHygMT-Orai3
\f0  after 
\f1 SalI
\f0 +
\f1 XbaI
\f0  double digestion, because 
\f1 XbaI
\f0  is blocked by dam methylation.\
The use of 
\f1 KpnI
\f0 , whose site is specific to Orai3 and 
\f1 XhoI
\f0 , specific to the vector allowed us to determine whether Orai3 inserted properly. Successful insertion in the 5\'b4 to 3\'b4 direction, would yield the 796 bp band observed in lane 3 of figure\'a03.2. After restriction digest analysis, clones which displayed the expected bands were sent for sequence verification. Sequence analysis on 
\f1 pucHygMT-Orai3
\f0  found no mutations in the Orai3 sequence. This experiment and the subsequent sequence analysis were important in providing confirmation that the 
\f1 pucHygMT-Orai3
\f0  construct was successfully generated. \
With our 
\f1 pucHygMT-STIM1
\f0  construct, there were no issues with dam methylation, and so 
\f1 XbaI
\f0  could be used. Lane 4 shows the 2066 bp and 
\f4 \uc0\u8764 
\f0 6994 bp bands we expect from 
\f1 SalI
\f0 +
\f1 XbaI
\f0  digestion, along with a linearized 
\f4 \uc0\u8764 
\f0 9060 bp product. The result of 
\f1 StuI
\f0 +
\f1 XhoI
\f0  and 
\f1 BamHI
\f0 +
\f1 StuI
\f0  digestions in lanes 1 and 2 respectively, confirm insertion of STIM1in the correct direction. Together, these restriction digests confirm that the 
\f1 pucHygMT-STIM1
\f0  was also successfully created, and in the proper direction. Following restriction digest analysis, 
\f1 pucHygMT-STIM1
\f0  clones which displayed the expected bands were also sent for sequence verification. Sequence analysis on 
\f1 pucHygMT-STIM1
\f0  DNA confirmed the sequence and direction of STIM1 insertion as well. \
The presence of mammalian STIM1 with 200 \'c2\'b5M 2-APB, while not able to increase SOCE, slows the inactivation of 
\i dOrai
\i0 . This results in a significant increase of intracellular calcium, when compared to the mock and other transfections. Support for theory of alteration of pore selectivity?  If the slowing of inactivation of 
\i dOrai
\i0  currents was due to an increase in the 2-APB which somehow affected the SERCA pump, a drug whose effects are not reversible (personal communication, Dr. J. Ashot Kozak), then we would expect to see similar results in all the other transfections, due to the effects of the hypothetical CPA washout. Figure\'a03.10\
Why is there a 200 uM 2-APB response in mock transfected cells?  It could be that 2-APB at this concentration is affecting some other channel populations. An increase in the transfected cells may be the result of orai3/stim1 ca entry, on top of these other calcium transients.\
\pard\pardeftab720\sb240\sa120

\b\fs32 \cf0 4.1  Discussion & Future Work\
\pard\pardeftab720\sb60\qj

\b0\fs24 \cf0 It is possible that the endogenous 
\i dOrai
\i0  and 
\i dStim
\i0  proteins will, on the basis of their similarity with the human orthologs, have some contribution to the Ca measurements obtained. \
\pard\pardeftab720\fi40\qj
\cf0 droso are very amenable to RNA interference (RNAi), which can be used to knock down specific genes, based on their sequence. Future work will be to create stable cell lines, expressing our genes of interest. The vectors used, were designed with this goal in mind, and only Hygromycin B selection of S2 cells transfected with our construct remains. Furthermore, by knocking down 
\i dOrai
\i0  and 
\i dStim
\i0  using RNAi, and repeating the experiments, the contribution of the endogenous genes can be determined.\
More work is necessary to make this system useable for the purpose of drug discovery, but the foundation of this work has already been laid. Creation of stable cell lines expressing our genes of interest is currently being undertaken. These stably expressed STIM1 and Orai3 lines will allow us to answer questions on protein expression of the channel. Due to the unexpected result we get from STIM1 expression with 200 \uc0\u956  2-APB, it is very unlikely that STIM1 is not being expressed. The stable cell line will allow us to study the novel behavior of STIM1 in this model system. important questions such as, the channel heterologous STIM1 seems to be affecting, will be answered more easily due to the creation of this cell line. ************ Given that STIM1 expresses, it seems unlikely that Orai3, which was made in a similar manner is not expressing. ************ More likely it is interacting with 
\i dOrai
\i0  and the result of these heteromeric channels are what we are looking at.\
See supplemental figure. GFP only, Stim1 + GFP transient transfection, STIM1 + GFP after 1 month of selection. See supplemental figure. No 2-APB in untransfected cells. \
See Goto2010 for example of ORAI3 activation dependent on STIM. Precedent exists. \
\pard\pardeftab720\sb120\sa120

\b\fs32 \cf0 Bibliography\
\pard\pardeftab720\li450\fi-450\sb60

\b0\fs20 \cf0 [12000Asmild and WillumsenAsmild and Willumsen]	Asmild, M. and Willumsen, N.\'a0J. 2000. Chloride channels in the plasma membrane of a foetal Drosophila cell line, S2. 
\i Pfl\'fcgers Archiv : European journal of physiology
\i0 \'a0
\i 439,
\i0 \'a06, 759\'9664.\
\pard\pardeftab720\li450\fi-450
\cf0 [22000Baksh and BurakoffBaksh and Burakoff]	Baksh, S. and Burakoff, S.\'a0J. 2000. The role of calcineurin in lymphocyte activation. 
\i Seminars in immunology
\i0 \'a0
\i 12,
\i0 \'a04, 405\'9615.\
[32008Baum and CherbasBaum and Cherbas]	Baum, B. and Cherbas, L. 2008. Drosophila cell lines as model systems and as an experimental tool. In 
\i Drosophila: Methods and Protocols
\i0 , C.\'a0Dahmann, Ed. Vol. 420. Humana Press, Totowa, NJ, Chapter\'a025, 391\'96424.\
[42003Berridge et\'a0al@x .Berridge, Bootman, and Roderick]	Berridge, M.\'a0J., Bootman, M.\'a0D., and Roderick, H.\'a0L. 2003. Calcium signalling: dynamics, homeostasis and remodelling. 
\i Nature Reviews Molecular Cell Biology
\i0 \'a0
\i 4,
\i0 \'a07, 517\'96529.\
[52000Berridge et\'a0al@x .Berridge, Lipp, and Bootman]	Berridge, M.\'a0J., Lipp, P., and Bootman, M.\'a0D. 2000. The versatility and universality of calcium signalling. 
\i Nature Reviews Molecular Cell Biology
\i0 \'a0
\i 1,
\i0 \'a01, 11\'9621.\
[62002Bilmen et\'a0al@x .Bilmen, Wootton, Godfrey, Smart, and Michelangeli]	Bilmen, J.\'a0G., Wootton, L.\'a0L., Godfrey, R.\'a0E., Smart, O.\'a0S., and Michelangeli, F. 2002. Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB). 
\i European Journal of Biochemistry
\i0 \'a0
\i 269,
\i0 \'a015, 3678\'963687.\
[71988Bunch et\'a0al@x .Bunch, Grinblat, and Goldstein]	Bunch, T., Grinblat, Y., and Goldstein, L. 1988. Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. 
\i Nucleic acids research
\i0 \'a0
\i 16,
\i0 \'a03, 1043\'9661.\
[81994ChumakovChumakov]	Chumakov, K. 1994. Reverse transcriptase can inhibit PCR and stimulate primer-dimer formation. 
\i PCR Methods and Applications
\i0 \'a0
\i 4,
\i0 \'a01, 62\'9664.\
[92003Cordova et\'a0al@x .Cordova, Delpech, Sattelle, and Rauh]	Cordova, D., Delpech, V.\'a0R., Sattelle, D.\'a0B., and Rauh, J.\'a0J. 2003. Spatiotemporal calcium signaling in a Drosophila melanogaster cell line stably expressing a Drosophila muscarinic acetylcholine receptor. 
\i Invertebrate neuroscience
\i0 \'a0
\i 5,
\i0 \'a01, 19\'9628.\
[102011Dellis et\'a0al@x .Dellis, Mercier, and Chomienne]	Dellis, O., Mercier, P., and Chomienne, C. 2011. The boron-oxygen core of borinate esters is responsible for the store-operated calcium entry potentiation ability. 
\i BMC pharmacology
\i0 \'a0
\i 11,
\i0 \'a01, 1.\
[111990Di Virgilio et\'a0al@x .Di Virgilio, Steinberg, and Silverstein]	Di Virgilio, F., Steinberg, T.\'a0H., and Silverstein, S.\'a0C. 1990. Inhibition of Fura-2 sequestration and secretion with organic anion transport blockers. 
\i Cell calcium
\i0 \'a0
\i 11,
\i0 \'a02-3, 57\'9662.\
[121998Eble et\'a0al@x .Eble, Wucherpfennig, Gauthier, Dersch, Krukonis, Isberg, and Hemler]	Eble, J.\'a0a., Wucherpfennig, K.\'a0W., Gauthier, L., Dersch, P., Krukonis, E., Isberg, R.\'a0R., and Hemler, M.\'a0E. 1998. Recombinant soluble human alpha 3 beta 1 integrin: purification, processing, regulation, and specific binding to laminin-5 and invasin in a mutually exclusive manner. 
\i Biochemistry
\i0 \'a0
\i 37,
\i0 \'a031, 10945\'9655.\
[132008Eid et\'a0al@x .Eid, Arias, Robertson, Hime, and Dziadek]	Eid, J.-P., Arias, A.\'a0M., Robertson, H., Hime, G.\'a0R., and Dziadek, M. 2008. The Drosophila STIM1 orthologue, dSTIM, has roles in cell fate specification and tissue patterning. 
\i BMC developmental biology
\i0 \'a0
\i 8,
\i0 \'a01, 104.\
[142006Feske et\'a0al@x .Feske, Gwack, Prakriya, Srikanth, Puppel, Tanasa, Hogan, Lewis, Daly, and Rao]	Feske, S., Gwack, Y., Prakriya, M., Srikanth, S., Puppel, S.-H., Tanasa, B., Hogan, P.\'a0G., Lewis, R.\'a0S., Daly, M., and Rao, A. 2006. A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. 
\i Nature
\i0 \'a0
\i 441,
\i0 \'a07090, 179\'96185.\
[152010Goto et\'a0al@x .Goto, Suzuki, Ozaki, Matsumoto, Nakamura, Ebisui, Fleig, Penner, and Mikoshiba]	Goto, J.-I., Suzuki, A.\'a0Z., Ozaki, S., Matsumoto, N., Nakamura, T., Ebisui, E., Fleig, A., Penner, R., and Mikoshiba, K. 2010. Two novel 2-aminoethyl diphenylborinate (2-APB) analogues differentially activate and inhibit store-operated Ca(2+) entry via STIM proteins. 
\i Cell calcium
\i0 \'a0
\i 47,
\i0 \'a01, 1\'9610.\
[162007Gwack et\'a0al@x .Gwack, Srikanth, Feske, Cruz-Guilloty, Oh-hora, Neems, Hogan, and Rao]	Gwack, Y., Srikanth, S., Feske, S., Cruz-Guilloty, F., Oh-hora, M., Neems, D., Hogan, P., and Rao, A. 2007. Biochemical and functional characterization of Orai proteins. 
\i Journal of Biological Chemistry
\i0 \'a0
\i 282,
\i0 \'a022, 16232\'9643.\
[171992Hoth and PennerHoth and Penner]	Hoth, M. and Penner, R. 1992. Depletion of intracellular calcium stores activates a calcium current in mast cells. 
\i Nature
\i0 \'a0
\i 355,
\i0 \'a06358, 353\'96356.\
[181995Johanson et\'a0al@x .Johanson, Appelbaum, Doyle, Hensley, Zhao, Abdel-Meguid, Young, Cook, Carr, Matico, and Others]	Johanson, K., Appelbaum, E., Doyle, M., Hensley, P., Zhao, B., Abdel-Meguid, S., Young, P., Cook, R., Carr, S., Matico, R., and Others. 1995. Binding Interactions of Human Interleukin 5 with Its Receptor \uc0\u945  Subunit. 
\i Journal of Biological Chemistry
\i0 \'a0
\i 270,
\i0 \'a016, 9459\'969471.\
[192006LambertLambert]	Lambert, D.\'a0G. 2006. 
\i Calcium signaling protocols
\i0 , 2nd ed. Methods in molecular biology. Humana Press, Totowa, NJ.\
[202008Lansdell et\'a0al@x .Lansdell, Collins, Yabe, Gee, Gibb, and Millar]	Lansdell, S.\'a0J., Collins, T., Yabe, A., Gee, V.\'a0J., Gibb, A.\'a0J., and Millar, N.\'a0S. 2008. Host-cell specific effects of the nicotinic acetylcholine receptor chaperone RIC-3 revealed by a comparison of human and Drosophila RIC-3 homologues. 
\i Journal of neurochemistry
\i0 \'a0
\i 105,
\i0 \'a05, 1573\'9681.\
[212001LewisLewis]	Lewis, R.\'a0S. 2001. Calcium signaling mechanisms in T lymphocytes. 
\i Annual review of immunology
\i0 \'a0
\i 19,
\i0 \'a0Figure 1, 497\'96521.\
[222005Liou et\'a0al@x .Liou, Kim, Heo, Jones, Myers, Ferrell, and Meyer]	Liou, J., Kim, M.\'a0L., Heo, W.\'a0D., Jones, J.\'a0T., Myers, J.\'a0W., Ferrell, J.\'a0E., and Meyer, T. 2005. STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. 
\i Current Biology
\i0 \'a0
\i 15,
\i0 \'a013, 1235\'961241.\
[232008Luce-Fedrow et\'a0al@x .Luce-Fedrow, Von Ohlen, Boyle, Ganta, and Chapes]	Luce-Fedrow, A., Von Ohlen, T., Boyle, D., Ganta, R.\'a0R., and Chapes, S.\'a0K. 2008. Use of Drosophila S2 cells as a model for studying Ehrlichia chaffeensis infections. 
\i Applied and environmental microbiology
\i0 \'a0
\i 74,
\i0 \'a06, 1886\'9691.\
[242000Masereeuw et\'a0al@x .Masereeuw, Van Pelt, Van Os, Willems, Smits, and Russel]	Masereeuw, R., Van Pelt, A., Van Os, S., Willems, P., Smits, P., and Russel, F. 2000. Probenecid interferes with renal oxidative metabolism: A potential pitfall in its use as an inhibitor of drug transport. 
\i British journal of pharmacology
\i0 \'a0
\i 131,
\i0 \'a01, 57\'9662.\
[252008Mignen et\'a0al@x .Mignen, Thompson, and Shuttleworth]	Mignen, O., Thompson, J.\'a0L., and Shuttleworth, T.\'a0J. 2008. Both Orai1 and Orai3 are essential components of the arachidonate-regulated Ca2+-selective (ARC) channels. 
\i The Journal of physiology
\i0 \'a0
\i 586,
\i0 \'a01, 185\'9695.\
[261995Millar et\'a0al@x .Millar, Baylis, Reaper, Bunting, Mason, and Sattelle]	Millar, N.\'a0S., Baylis, H.\'a0a., Reaper, C., Bunting, R., Mason, W.\'a0T., and Sattelle, D.\'a0B. 1995. Functional expression of a cloned Drosophila muscarinic acetylcholine receptor in a stable Drosophila cell line. 
\i The Journal of experimental biology
\i0 \'a0
\i 198,
\i0 \'a0Pt 9, 1843\'9650.\
[272007Moncoq et\'a0al@x .Moncoq, Trieber, and Young]	Moncoq, K., Trieber, C.\'a0a., and Young, H.\'a0S. 2007. The molecular basis for cyclopiazonic acid inhibition of the sarcoplasmic reticulum calcium pump. 
\i The Journal of biological chemistry
\i0 \'a0
\i 282,
\i0 \'a013, 9748\'9657.\
[281998PfeiferPfeifer]	Pfeifer, T. 1998. Expression of heterologous proteins in stable insect cell culture. 
\i Current opinion in biotechnology
\i0 \'a0
\i 9,
\i0 \'a05, 518\'9621.\
[292006Prakriya et\'a0al@x .Prakriya, Feske, Gwack, Srikanth, Rao, and Hogan]	Prakriya, M., Feske, S., Gwack, Y., Srikanth, S., Rao, A., and Hogan, P.\'a0G. 2006. Orai1 is an essential pore subunit of the CRAC channel. 
\i Nature
\i0 \'a0
\i 443,
\i0 \'a07108, 230\'96233.\
[302001Prakriya and LewisPrakriya and Lewis]	Prakriya, M. and Lewis, R.\'a0S. 2001. Potentiation and inhibition of Ca(2+) release-activated Ca(2+) channels by 2-aminoethyldiphenyl borate (2-APB) occurs independently of IP(3) receptors. 
\i The Journal of physiology
\i0 \'a0
\i 536,
\i0 \'a01, 3\'9619.\
[311986PutneyPutney]	Putney, J.\'a0W. 1986. A model for receptor-regulated calcium entry. 
\i Cell Calcium
\i0 \'a0
\i 7,
\i0 \'a01, 1\'9612.\
[322006PutneyPutney]	Putney, J.\'a0W. 2006. 
\i Calcium signaling
\i0 , 2nd ed. Methods in signal transduction. CRC Press, Boca Raton, FL.\
[332005Roos et\'a0al@x .Roos, DiGregorio, Yeromin, Ohlsen, Lioudyno, Zhang, Safrina, Kozak, Wagner, Cahalan, Veli\'e7elebi, and Stauderman]	Roos, J., DiGregorio, P.\'a0J., Yeromin, A.\'a0V., Ohlsen, K., Lioudyno, M., Zhang, S., Safrina, O., Kozak, J.\'a0A., Wagner, S.\'a0L., Cahalan, M.\'a0D., Veli\'e7elebi, G., and Stauderman, K.\'a0a. 2005. STIM1, an essential and conserved component of store-operated Ca2+ channel function. 
\i The Journal of cell biology
\i0 \'a0
\i 169,
\i0 \'a03, 435\'9645.\
[342004Schetz and ShankarSchetz and Shankar]	Schetz, J.\'a0a. and Shankar, E. P.\'a0N. 2004. Protein expression in the Drosophila Schneider 2 cell system. 
\i Current protocols in neuroscience
\i0 \'a0
\i Chapter 4
\i0 , 4.16.1\'9615.\
[351972SchneiderSchneider]	Schneider, I. 1972. Cell lines derived from late embryonic stages of Drosophila melanogaster. 
\i Journal of embryology and experimental morphology
\i0 \'a0
\i 27,
\i0 \'a02, 353\'9665.\
[362010Smyth et\'a0al@x .Smyth, Hwang, Tomita, DeHaven, Mercer, and Putney]	Smyth, J., Hwang, S., Tomita, T., DeHaven, W., Mercer, J., and Putney, J. 2010. Activation and regulation of store-operated calcium entry. 
\i Journal of Cellular and Molecular Medicine
\i0 \'a0
\i 14,
\i0 \'a010, 2337\'962349.\
[372006Soboloff et\'a0al@x .Soboloff, Spassova, Hewavitharana, He, Xu, Johnstone, Dziadek, and Gill]	Soboloff, J., Spassova, M.\'a0A., Hewavitharana, T., He, L.-P., Xu, W., Johnstone, L.\'a0S., Dziadek, M.\'a0A., and Gill, D.\'a0L. 2006. STIM2 is an inhibitor of STIM1-mediated store-operated Ca2+ Entry. 
\i Current Biology
\i0 \'a0
\i 16,
\i0 \'a014, 1465\'961470.\
[381983Streb et\'a0al@x .Streb, Irvine, Berridge, and Schulz]	Streb, H., Irvine, R.\'a0F., Berridge, M.\'a0J., and Schulz, I. 1983. Release of Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. 
\i Nature
\i0 \'a0
\i 306,
\i0 \'a05938, 67\'9669.\
[392006TaylorTaylor]	Taylor, C. 2006. Store-operated Ca2+ entry: a STIMulating stOrai. 
\i Trends in biochemical sciences
\i0 \'a0
\i 31,
\i0 \'a011, 597\'96601.\
[401996Timmerman et\'a0al@x .Timmerman, Clipstone, Ho, Northrop, and Crabtree]	Timmerman, L.\'a0A., Clipstone, N.\'a0A., Ho, S.\'a0N., Northrop, J.\'a0P., and Crabtree, G.\'a0R. 1996. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. 
\i Nature
\i0 \'a0
\i 383,
\i0 \'a06603, 837\'96840.\
[412006Vig et\'a0al@x .Vig, Peinelt, Beck, Koomoa, Rabah, Koblan-Huberson, Kraft, Turner, Fleig, Penner, and Kinet]	Vig, M., Peinelt, C., Beck, A., Koomoa, D.\'a0L., Rabah, D., Koblan-Huberson, M., Kraft, S., Turner, H., Fleig, A., Penner, R., and Kinet, J.-P. 2006. CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. 
\i Science
\i0 \'a0
\i 312,
\i0 \'a05777, 1220\'963.\
[422001Williams et\'a0al@x .Williams, Manji, Parker, Hancock, Van Stekelenburg, Eid, Senior, Kazenwadel, Shandala, Saint, Smith, and Dziadek]	Williams, R., Manji, S., Parker, N., Hancock, M., Van Stekelenburg, L., Eid, J., Senior, P., Kazenwadel, J., Shandala, T., Saint, R., Smith, P.\'a0J., and Dziadek, M.\'a0A. 2001. Identification and characterization of the STIM (stromal interaction molecule) gene family: coding for a novel class of transmembrane proteins. 
\i Biochemical Journal
\i0 \'a0
\i 357,
\i0 \'a03, 673\'96685.\
[432010Xu et\'a0al@x .Xu, Li, Zhang, Song, Chen, Duan, Xu, and Liao]	Xu, Y.-B., Li, H.-P., Zhang, J.-B., Song, B., Chen, F.-F., Duan, X.-J., Xu, H.-Q., and Liao, Y.-C. 2010. Disruption of the chitin synthase gene CHS1 from Fusarium asiaticum results in an altered structure of cell walls and reduced virulence. 
\i Fungal genetics and biology
\i0 \'a0
\i 47,
\i0 \'a03, 205\'9615.\
[441999Yagodin et\'a0al@x .Yagodin, Pivovarova, Andrews, and Sattelle]	Yagodin, S., Pivovarova, N.\'a0B., Andrews, S.\'a0B., and Sattelle, D.\'a0B. 1999. Functional characterization of thapsigargin and agonist-insensitive acidic Ca2+ stores in Drosophila melanogaster S2 cell lines. 
\i Cell calcium
\i0 \'a0
\i 25,
\i0 \'a06, 429\'9638.\
[452004Yeromin et\'a0al@x .Yeromin, Roos, a\'a0Stauderman, and Cahalan]	Yeromin, A.\'a0V., Roos, J., a\'a0Stauderman, K., and Cahalan, M.\'a0D. 2004. A store-operated calcium channel in Drosophila S2 cells. 
\i The Journal of general physiology
\i0 \'a0
\i 123,
\i0 \'a02, 167\'96182.\
[462008Zhang et\'a0al@x .Zhang, Kozak, Jiang, Yeromin, Chen, Yu, Penna, Shen, Chi, and Cahalan]	Zhang, S.\'a0L., Kozak, J.\'a0A., Jiang, W., Yeromin, A.\'a0V., Chen, J., Yu, Y., Penna, A., Shen, W., Chi, V., and Cahalan, M.\'a0D. 2008. Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3. 
\i The Journal of biological chemistry
\i0 \'a0
\i 283,
\i0 \'a025, 17662\'9671.\
[472006Zhang et\'a0al@x .Zhang, Yeromin, Zhang, Yu, Safrina, Penna, Roos, Stauderman, and Cahalan]	Zhang, S.\'a0L., Yeromin, A.\'a0V., Zhang, X. H.-F., Yu, Y., Safrina, O., Penna, A., Roos, J., Stauderman, K.\'a0a., and Cahalan, M.\'a0D. 2006. Genome-wide RNAi screen of Ca(2+) influx identifies genes that regulate Ca(2+) release-activated Ca(2+) channel activity. 
\i Proceedings of the National Academy of Sciences of the United States of America
\i0 \'a0
\i 103,
\i0 \'a024, 9357\'9662.\
[482005Zhang et\'a0al@x .Zhang, Yu, Roos, Kozak, Deerinck, Ellisman, Stauderman, and Cahalan]	Zhang, S.\'a0L., Yu, Y., Roos, J., Kozak, J.\'a0A., Deerinck, T.\'a0J., Ellisman, M.\'a0H., Stauderman, K.\'a0A., and Cahalan, M.\'a0D. 2005. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. 
\i Nature
\i0 \'a0
\i 437,
\i0 \'a07060, 902\'96905.\
[491993Zweifach and LewisZweifach and Lewis]	Zweifach, A. and Lewis, R.\'a0S. 1993. Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores. 
\i Proceedings of the National Academy of Sciences of the United States of America
\i0 \'a0
\i 90,
\i0 \'a013, 6295\'969.\
}