issues Search Results · repo:igordot/genomics language:R
Filter by
6 results
(54 ms)6 results
inigordot/genomics (press backspace or delete to remove)Hi, is anyone sure if the ribosome fasta file created is hg19 or hg38?
UNSWGiiGii
- 1
- Opened on Dec 7, 2022
- #9
Hi, Is anyone aware if the ribosome fasta file created is hg19 or hg38?
UNSWGiiGii
- Opened on Dec 7, 2022
- #8
Hi Igor, small thing - in the calculate_cluster_expression function it throws this error:
Error in rownames_to_column(., gene ) : is.data.frame(df) is not TRUE
Calls: calculate_cluster_expression - ...
mcornwell1957
- 2
- Opened on May 11, 2021
- #7
HI, What should be in file format for adding the GFP to the cDNA file ? I am trying to add
GFP
ATGCCCGCCATGAAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAA ...
amitpande74
- 3
- Opened on Apr 27, 2021
- #6
THere is no stop codon. Not sure if there is more sequence following the AAG, or there should be a stop. But just wanted
to let you know.
niko-balanis
- 4
- Opened on Nov 6, 2019
- #4
Hi I used the given method to create the ribosomal RNA reference sequence using Rfam 14.1 for humans (species=
homo_sapiens ). After following all your steps I am left with 0 rRNAs in order to proceed ...
biobug16
- 1
- Opened on Aug 28, 2019
- #3

Learn how you can use GitHub Issues to plan and track your work.
Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub IssuesProTip!
Press the /
key to activate the search input again and adjust your query.
Learn how you can use GitHub Issues to plan and track your work.
Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub IssuesProTip!
Restrict your search to the title by using the in:title qualifier.