diff --git a/flexiplex.c++ b/flexiplex.c++ index 9b661d7..8a8ff46 100644 --- a/flexiplex.c++ +++ b/flexiplex.c++ @@ -17,16 +17,39 @@ #include #include #include -#include +#include +#include +#include +#include +#include #include "edlib.h" +#include using namespace std; // Append .1 to version for dev code, remove for release // e.g. 1.00.1 (dev) goes to 1.01 (release) -const static string VERSION="1.02.5"; +const static string VERSION="1.02.6"; + +enum SegmentType { FIXED, MATCHED, MATCHED_SPLIT, RANDOM }; + +struct Segment { + SegmentType type; + std::string pattern; + std::string name; // e.g., "BC1", "UMI", "Primer1" + std::string bc_list_name; // Only for MATCHED, refers to a key in known_barcodes_map + int buffer_size; // for MATCHED, MATCHED_SPLIT + int max_edit_distance; // for MATCHED, MATCHED_SPLIT +}; + +struct BarcodeGroup { + std::string name; + int max_edit_distance; + std::vector segment_indices; +}; +// can have other properties struct PredefinedStruct { string description; string params; @@ -43,7 +66,7 @@ static const map< string, PredefinedStruct> predefinedMap = { {"10x5v2",{"10x version 2 chemistry 5'", "-x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ?????????? -x TTTCTTATATGGG -f 8 -e 2"}}, {"grep",{"Simple grep-like search (edit distance up to 2)", - "-f 2 -k ? -b \'\' -u \'\' -i false"}} + "-f 2 -k ? -b '' -u '' -i false"}} }; // the help information which is printed when a user puts in the wrong @@ -67,6 +90,9 @@ void print_usage(){ cerr << " @BC_UMI#READID_+1of2\n"; cerr << " is chimeric, it will become:\n"; cerr << " @BC_UMI#READID_+1of2_C\n"; + cerr << " Reads are considered chimeric if barcodes are found on both\n"; + cerr << " forward and reverse strands.\n"; + // what about when only one strand has multiple barcodes? cerr << " -n prefix Prefix for output filenames.\n"; cerr << " -e N Maximum edit distance to barcode (default 2).\n"; cerr << " -f N Maximum edit distance to primer+polyT (default 8).\n"; @@ -74,15 +100,25 @@ void print_usage(){ cerr << " Specifying adaptor / barcode structure : \n"; cerr << " -x sequence Append flanking sequence to search for\n"; - cerr << " -b sequence Append the barcode pattern to search for\n"; - cerr << " -u sequence Append the UMI pattern to search for\n"; - cerr << " Notes:\n"; - cerr << " The order of these options matters\n"; - cerr << " ? - can be used as a wildcard\n"; + cerr << " -u sequence[,name:] Append the UMI pattern to search for\n"; + cerr << " (named UB, UB2, UB3... by default if name not provided)\n"; + cerr << " -b sequence[,name:][,list:][,group:][,buffer:][,max_ed:]\n"; + cerr << " Append a barcode pattern with optional parameters\n"; + cerr << " - name: specify the name of the barcode segment (defaults to BC1, BC2...)\n"; + cerr << " - list: specify a file containing expected barcodes for this segment\n"; + cerr << " - group: specify the group name for this segment\n"; + cerr << " Barcodes in the same group will be treated as parts of a single barcode\n"; + cerr << " - buffer: number of bases to extend search region on either side (default 5)\n"; + cerr << " - max_ed: maximum edit distance for this segment (default is global -e value)\n"; + cerr << " -g name,list:[,max_ed:]\n"; + cerr << " Define a barcode group (multiple barcode segments joined together)\n"; + cerr << " - name: unique name for the group\n"; + cerr << " - list: specify a file containing expected barcodes for this group\n"; + cerr << " - max_ed: maximum edit distance allowed for the entire group\n"; cerr << " When no search pattern x,b,u option is provided, the following default pattern is used: \n"; cerr << " primer: CTACACGACGCTCTTCCGATCT\n"; - cerr << " barcode: ????????????????\n"; - cerr << " UMI: ????????????\n"; + cerr << " barcode (CB): ????????????????\n"; + cerr << " UMI (UB): ????????????\n"; cerr << " polyT: TTTTTTTTT\n"; cerr << " which is the same as providing: \n"; cerr << " -x CTACACGACGCTCTTCCGATCT -b ???????????????? -u ???????????? -x TTTTTTTTT\n\n"; @@ -120,16 +156,61 @@ void reverse_complement(string & seq){ transform(seq.begin(),seq.end(),seq.begin(),complement); } -//Holds the found barcode and associated information +// Holds the found barcode and associated information struct Barcode { - string barcode; - string umi; - int editd; - int flank_editd; - int flank_start; - int flank_end; - bool unambiguous; -} ; + std::map features; // Map of segment name to extracted sequence + int flank_editd = 100; + int flank_start = -1; + int flank_end = -1; // inclusive + bool found_all_matched_segments = true; +}; + +// A thread-safe queue for our producer-consumer model +template +class ThreadSafeQueue { +private: + std::queue queue_; + mutable std::mutex mutex_; + std::condition_variable cond_; + std::condition_variable cond_not_full_; + size_t capacity_ = 0; // 0 => unbounded + +public: + ThreadSafeQueue() = default; + explicit ThreadSafeQueue(size_t capacity) : capacity_(capacity) {} + + void push(T value) { + std::unique_lock lock(mutex_); + if (capacity_ > 0) { + cond_not_full_.wait(lock, [this] { return queue_.size() < capacity_; }); + } + queue_.push(std::move(value)); + lock.unlock(); + cond_.notify_one(); + } + + // Pop an element from the queue. Blocks until an element is available. + // Returns true if a value was popped. + bool pop(T& value) { + std::unique_lock lock(mutex_); + cond_.wait(lock, [this] { return !queue_.empty(); }); + + value = std::move(queue_.front()); + queue_.pop(); + lock.unlock(); + + if (capacity_ > 0) { + cond_not_full_.notify_one(); + } + return true; + } + + void notify_all_finish() { + std::lock_guard lock(mutex_); + cond_.notify_all(); + cond_not_full_.notify_all(); + } +}; struct SearchResult { string read_id; @@ -138,19 +219,61 @@ struct SearchResult { string rev_line; vector vec_bc_for; vector vec_bc_rev; - int count; - bool chimeric; + int count = 0; + bool chimeric = false; }; +// Forward declaration +vector big_barcode_search( + const string &sequence, + const std::unordered_map> *known_barcodes_map, + const std::unordered_map *group_map, + int global_flank_max_editd, + int global_barcode_edit_distance, + const std::vector &segments); + +// Separated out from main so it can be run on batches in threads (deterministic output) +static void search_read_batch( + std::vector &reads, + const std::unordered_map> &known_barcodes_map, + const std::unordered_map &group_map, + int flank_edit_distance, + int global_barcode_edit_distance, + const std::vector &search_pattern) { + + for (auto &sr : reads) { + // forward search + sr.vec_bc_for = big_barcode_search(sr.line, &known_barcodes_map, &group_map, + flank_edit_distance, + global_barcode_edit_distance, + search_pattern); + + // reverse complement + sr.rev_line = sr.line; + reverse_complement(sr.rev_line); + + // reverse search + sr.vec_bc_rev = big_barcode_search(sr.rev_line, &known_barcodes_map, &group_map, + flank_edit_distance, + global_barcode_edit_distance, + search_pattern); + + sr.count = (int)sr.vec_bc_for.size() + (int)sr.vec_bc_rev.size(); + sr.chimeric = !sr.vec_bc_for.empty() && !sr.vec_bc_rev.empty(); + } +} + // Code for fast edit distance calculation for short sequences modified from // https://en.wikibooks.org/wiki/Algorithm_Implementation/Strings/Levenshtein_distance#C++ // s2 is always assumned to be the shorter string (barcode) unsigned int edit_distance(const std::string& s1, const std::string& s2, unsigned int &end, int max_editd){ - std::size_t len1 = s1.size()+1, len2 = s2.size()+1; - const char * s1_c = s1.c_str(); const char * s2_c = s2.c_str(); + const std::size_t len1 = s1.size() + 1, len2 = s2.size() + 1; + const char *s1_c = s1.c_str(); const char *s2_c = s2.c_str(); - vector< unsigned int> dist_holder(len1*len2); + // Reuse DP buffer per-thread to reduce allocator churn. + thread_local std::vector dist_holder; + dist_holder.assign(len1 * len2, 0u); //initialise the edit distance matrix. //penalise for gaps at the start and end of the shorter sequence (j) //but not for shifting the start/end of the longer sequence (i,0) @@ -158,14 +281,14 @@ unsigned int edit_distance(const std::string& s1, const std::string& s2, unsigne for(unsigned int j = 1; j < len2; ++j) dist_holder[j] = j; //[0][j]; for(unsigned int i = 1; i < len1; ++i) dist_holder[i*len2] = 0; //[i][0]; - int best=len2; - end=len1-1; + int best = len2; + end = len1 - 1; //loop over the distance matrix elements and calculate running distance for (unsigned int j = 1; j < len2; ++j) { bool any_below_threshold = false; // flag used for early exit for (unsigned int i = 1; i < len1; ++i) { - int sub = (s1_c[i - 1] == s2_c[j - 1]) ? 0 : 1; // are the bases the same? + const int sub = (s1_c[i - 1] == s2_c[j - 1]) ? 0 : 1; // are the bases the same? // if yes, no need to increment distance if (sub == 0) { @@ -202,267 +325,533 @@ unsigned int edit_distance(const std::string& s1, const std::string& s2, unsigne return best; // return edit distance } -// extract UMI from the read after barcode matching -std::string get_umi(const std::string &seq, - const std::vector> &search_pattern, - const std::vector &read_to_subpatterns, - const int umi_index, const int bc_index, - const bool sliding_window_match, // if true, use left_bound and endDistance - const int left_bound, - const int endDistance - ) { - - int umi_start, umi_length; - std::string umi_pad = ""; - umi_length = search_pattern[umi_index].second.length(); - - if (umi_index == -1) { - return ""; // protocol does not have UMI - - } else if (umi_index == bc_index + 1) { - // UMI right after BC - if (sliding_window_match) { - umi_start = left_bound + endDistance; - } else { - umi_start = read_to_subpatterns[bc_index] + search_pattern[bc_index].second.length(); - } - if (seq.length() < umi_start + umi_length) { - // read not long enough, pad N to the end - umi_length = seq.length() - umi_start; - umi_pad = std::string(search_pattern[umi_index].second.length() - umi_length, 'N'); - } - return seq.substr(umi_start, umi_length) + umi_pad; - - } else if (umi_index == bc_index - 1) { - // UMI right before BC - int bc_start = sliding_window_match ? left_bound + endDistance : read_to_subpatterns[bc_index]; - // umi should start umi_offset bases before BC - int umi_offset = search_pattern[bc_index].second.length() + search_pattern[umi_index].second.length(); - if (bc_start < umi_offset) { - // not enough bases before BC - umi_pad = std::string(umi_offset - bc_start, 'N'); - umi_start = 0; - umi_length -= umi_offset - bc_start; - } else { - umi_start = bc_start - umi_offset; - } - return umi_pad + seq.substr(umi_start, umi_length); - - } else { - // UMI not next to BC, no idea which side was truncated - if (read_to_subpatterns.size() > umi_index + 1) { - // UMI is not the last subpattern - // use the start of the next subpattern as the end of UMI - umi_start = read_to_subpatterns[umi_index]; - umi_length = min(read_to_subpatterns[umi_index + 1] - umi_start, umi_length); - umi_pad = std::string(search_pattern[umi_index].second.length() - umi_length, 'N'); - return seq.substr(umi_start, umi_length) + umi_pad; - } else { - // UMI is the last subpattern - umi_start = read_to_subpatterns[umi_index]; - umi_length = min((int) seq.length() - umi_start, umi_length); - umi_pad = std::string(search_pattern[umi_index].second.length() - umi_length, 'N'); - return seq.substr(umi_start, umi_length) + umi_pad; - } - } -} +// Forward declarations +bool align_read_to_pattern(const string &seq, + const std::vector &segments, + int global_flank_max_editd, + Barcode &barcode_result, + std::vector &read_to_segment_starts); +void refine_matched_segments(const string &seq, + const std::vector &segments, + const std::unordered_map> *known_barcodes_map, + const std::vector &read_to_segment_starts, + Barcode &barcode_result, + std::vector &refined_segment_starts, + std::vector &refined_segment_ends); +void refine_split_segments(const string &seq, + const std::vector &segments, + const std::unordered_map> *known_barcodes_map, + const std::unordered_map *group_map, + const std::vector &read_to_segment_starts, + Barcode &barcode_result, + std::vector &refined_segment_starts, + std::vector &refined_segment_ends); +void extract_random_segments(const string &seq, + const std::vector &segments, + const std::vector &read_to_segment_starts, + const std::vector &refined_segment_starts, + const std::vector &refined_segment_ends, + Barcode &barcode_result); // Given a string 'seq' search for substring with primer and polyT sequence followed by // a targeted search in the region for barcode // Sequence seearch is performed using edlib -Barcode get_barcode(string & seq, - unordered_set *known_barcodes, - int flank_max_editd, - int barcode_max_editd, - const std::vector> &search_pattern) { +Barcode extract_features(string & seq, + const std::vector &segments, + const std::unordered_map> *known_barcodes_map, + const std::unordered_map *group_map, + int global_flank_max_editd, + int global_barcode_edit_distance) { + + Barcode barcode_result; + barcode_result.found_all_matched_segments = true; + barcode_result.flank_editd = 100; + + vector read_to_segment_starts; + + // 1. Align reads to get approximate positions + bool aligned = align_read_to_pattern(seq, segments, global_flank_max_editd, barcode_result, read_to_segment_starts); + + if (!aligned) return barcode_result; + + // Storage for refined positions from matched segments + std::vector refined_segment_starts(segments.size(), -1); + std::vector refined_segment_ends(segments.size(), -1); + + // 2. Process MATCHED segments (Single barcodes) + refine_matched_segments(seq, segments, known_barcodes_map, read_to_segment_starts, barcode_result, refined_segment_starts, refined_segment_ends); + + // 3. Process MATCHED_SPLIT segments (Grouped/Split barcodes) + if (group_map && !group_map->empty()) { + refine_split_segments(seq, segments, known_barcodes_map, group_map, read_to_segment_starts, barcode_result, refined_segment_starts, refined_segment_ends); + } + + if (!barcode_result.found_all_matched_segments) { + return barcode_result; + } + + // 4. Process RANDOM segments using refined anchors + extract_random_segments(seq, segments, read_to_segment_starts, refined_segment_starts, refined_segment_ends, barcode_result); - const int OFFSET=5; //wiggle room in bases of the expected barcode start site to search. + return barcode_result; +} - //initialise struct variables for return: - Barcode barcode; - barcode.editd=100; barcode.flank_editd=100; barcode.unambiguous = false; +// Helper: Align read to the concatenated pattern using Edlib +bool align_read_to_pattern(const string &seq, + const std::vector &segments, + int global_flank_max_editd, + Barcode &barcode_result, + std::vector &read_to_segment_starts) { - //initialise edlib configuration - // Use IUPAC codes + // Edlib Configuration EdlibEqualityPair additionalEqualities[28] = { - {'R', 'A'}, {'R', 'G'}, - {'K', 'G'}, {'K', 'T'}, - {'S', 'G'}, {'S', 'C'}, - {'Y', 'C'}, {'Y', 'T'}, - {'M', 'A'}, {'M', 'C'}, - {'W', 'A'}, {'W', 'T'}, - {'B', 'C'}, {'B', 'G'}, {'B', 'T'}, - {'H', 'A'}, {'H', 'C'}, {'H', 'T'}, + {'R', 'A'}, {'R', 'G'}, {'K', 'G'}, {'K', 'T'}, + {'S', 'G'}, {'S', 'C'}, {'Y', 'C'}, {'Y', 'T'}, + {'M', 'A'}, {'M', 'C'}, {'W', 'A'}, {'W', 'T'}, + {'B', 'C'}, {'B', 'G'}, {'B', 'T'}, {'H', 'A'}, {'H', 'C'}, {'H', 'T'}, {'?', 'A'}, {'?', 'C'}, {'?', 'G'}, {'?', 'T'}, - {'D', 'A'}, {'D', 'G'}, {'D', 'T'}, - {'V', 'A'}, {'V', 'C'}, {'V', 'G'} + {'D', 'A'}, {'D', 'G'}, {'D', 'T'}, {'V', 'A'}, {'V', 'C'}, {'V', 'G'} }; - EdlibAlignConfig edlibConf = {flank_max_editd, EDLIB_MODE_HW, EDLIB_TASK_PATH, additionalEqualities, 28}; + EdlibAlignConfig edlibConf = {global_flank_max_editd, EDLIB_MODE_HW, EDLIB_TASK_PATH, additionalEqualities, 28}; - // concatenate patterns in search_pattern in insertion order - std::string search_string; - for (const auto &pair : search_pattern) { - search_string += pair.second; - } + // 1. Construct Search Template + // Optimization Note: This construction happens every call. If segments are static, + // the template string and lengths could be pre-calculated. + std::string search_string_template; + std::vector segment_lengths; + + search_string_template.reserve(256); + segment_lengths.reserve(segments.size()); - // shorter than the pattern, skip search - if (seq.length() < search_string.length()) { - return barcode; + for (const auto &segment : segments) { + search_string_template += segment.pattern; + segment_lengths.push_back(segment.pattern.length()); } - //search for the concatenated pattern - EdlibAlignResult result = edlibAlign(search_string.c_str(), search_string.length(), seq.c_str(), seq.length(), edlibConf); - if(result.status != EDLIB_STATUS_OK | result.numLocations==0 ){ + if (seq.length() < search_string_template.length()) return false; + + // 2. Perform Alignment + EdlibAlignResult result = edlibAlign(search_string_template.c_str(), search_string_template.length(), seq.c_str(), seq.length(), edlibConf); + + if (result.status != EDLIB_STATUS_OK || result.numLocations == 0) { edlibFreeAlignResult(result); - return(barcode); // no match found - return - } //fill in info about found primer and polyT location - barcode.flank_editd=result.editDistance; - barcode.flank_start=result.startLocations[0]; - barcode.flank_end=result.endLocations[0]; - - // Extract sub-patterns from aligment directly - std::vector subpattern_lengths; - for (const auto &pair : search_pattern) { - subpattern_lengths.push_back(pair.second.length()); + return false; } - std::vector subpattern_ends; - subpattern_ends.resize(subpattern_lengths.size()); - std::partial_sum(subpattern_lengths.begin(), subpattern_lengths.end(), subpattern_ends.begin()); + barcode_result.flank_editd = result.editDistance; + barcode_result.flank_start = result.startLocations[0]; + barcode_result.flank_end = result.endLocations[0]; - vector read_to_subpatterns; - read_to_subpatterns.reserve(subpattern_ends.size() + 1); - read_to_subpatterns.emplace_back(barcode.flank_start); + // 3. Map alignment to segment positions + std::vector segment_template_ends; + segment_template_ends.resize(segment_lengths.size()); + std::partial_sum(segment_lengths.begin(), segment_lengths.end(), segment_template_ends.begin()); - // initialise pointers - int i_read = barcode.flank_start; + read_to_segment_starts.reserve(segment_template_ends.size() + 1); + read_to_segment_starts.emplace_back(barcode_result.flank_start); + + int i_read = barcode_result.flank_start; int i_pattern = 0; - int i_subpattern = 0; - - // walk through edlib aligment - // 0 for match - // 1 for insertion to target - // 2 for insertion to query - // 3 for mismatch - std::vector alignment_vector(result.alignment, result.alignment + result.alignmentLength); - for (const auto& value : alignment_vector) { - if (value != 1) { - i_read++; - } - if (value != 2) { - i_pattern++; - } - if (i_pattern >= subpattern_ends[i_subpattern]) { - read_to_subpatterns.emplace_back(i_read); - i_subpattern++; + size_t i_segment = 0; + + // Avoid copying the alignment to a temporary vector. + for (int ai = 0; ai < result.alignmentLength; ++ai) { + const unsigned char value = result.alignment[ai]; + if (value != EDLIB_EDOP_INSERT) i_read++; + if (value != EDLIB_EDOP_DELETE) i_pattern++; + + if (i_segment < segment_template_ends.size() && + i_pattern >= (int)segment_template_ends[i_segment]) { + read_to_segment_starts.emplace_back(i_read); + i_segment++; } } edlibFreeAlignResult(result); + return true; +} +// Helper: Process direct MATCHED segments (Pass 1) +void refine_matched_segments(const string &seq, + const std::vector &segments, + const std::unordered_map> *known_barcodes_map, + const std::vector &read_to_segment_starts, + Barcode &barcode_result, + std::vector &refined_segment_starts, + std::vector &refined_segment_ends) { + + for (size_t i = 0; i < segments.size(); ++i) { + const Segment& s = segments[i]; + if (s.type != MATCHED) continue; + + const int segment_read_start = read_to_segment_starts[i]; + const int segment_read_end = + (i + 1 < read_to_segment_starts.size()) + ? read_to_segment_starts[i+1] + : barcode_result.flank_end; + + const unordered_set* current_bclist = nullptr; + if (!s.bc_list_name.empty()) { + auto it = known_barcodes_map->find(s.bc_list_name); + if (it != known_barcodes_map->end()) current_bclist = &(it->second); + } else if (known_barcodes_map->count("global")) { + current_bclist = &(known_barcodes_map->at("global")); + } - // Work out the index of BC and UMI in the pattern - // TODO: Should this be done in main to be more efficient? - // TODO: Handle edge cases where BC / UMI is not speficied in the pattern - int bc_index = -1, umi_index = -1; - auto it_pattern = - std::find_if(search_pattern.begin(), search_pattern.end(), - [](const std::pair &pair) { - return pair.first == "BC"; - }); - if (it_pattern != search_pattern.end()) { - bc_index = std::distance(search_pattern.begin(), it_pattern); - } else { - // error - } - it_pattern = - std::find_if(search_pattern.begin(), search_pattern.end(), - [](const std::pair &pair) { - return pair.first == "UMI"; - }); - if (it_pattern != search_pattern.end()) { - umi_index = std::distance(search_pattern.begin(), it_pattern); - } else { - // error + if (current_bclist && !current_bclist->empty()) { + const int search_start = max(0, segment_read_start - s.buffer_size); + const int search_end = min((int)seq.length(), segment_read_end + s.buffer_size); + const std::string search_region = seq.substr(search_start, search_end - search_start); + + unsigned int best_edit_distance = 100; + unsigned int best_end_distance = 0; + std::string best_barcode_match = ""; + int best_wiggle_offset = std::numeric_limits::max(); // Initialize with a large value + bool current_segment_unambiguous = false; + + for (const auto& known_bc : *current_bclist) { + unsigned int editDistance, endDistance; + editDistance = edit_distance(search_region, known_bc, endDistance, s.max_edit_distance); + + if (editDistance <= s.max_edit_distance) { // Only consider valid matches + // Calculate the start of the barcode in the original sequence + int current_match_start_in_seq = search_start + (endDistance - known_bc.length()); + // Calculate the wiggle offset from the ideal segment_read_start + int current_wiggle_offset = std::abs(current_match_start_in_seq - segment_read_start); + + if (editDistance < best_edit_distance) { + current_segment_unambiguous = true; + best_edit_distance = editDistance; + best_barcode_match = known_bc; + best_end_distance = endDistance; + best_wiggle_offset = current_wiggle_offset; + if (editDistance == 0 && current_wiggle_offset == 0) break; // Exact match, no wiggle + } else if (editDistance == best_edit_distance) { + if (current_wiggle_offset < best_wiggle_offset) { + current_segment_unambiguous = true; // Found a better wiggle + best_edit_distance = editDistance; // Keep same edit distance + best_barcode_match = known_bc; + best_end_distance = endDistance; + best_wiggle_offset = current_wiggle_offset; + } else if (current_wiggle_offset == best_wiggle_offset) { + current_segment_unambiguous = false; // Ambiguous if same edit distance and wiggle + } + // If current_wiggle_offset > best_wiggle_offset, do nothing, keep existing best + } + } + } + if (best_edit_distance <= s.max_edit_distance && current_segment_unambiguous) { + barcode_result.features[s.name] = best_barcode_match; + refined_segment_ends[i] = search_start + best_end_distance - 1; + refined_segment_starts[i] = refined_segment_ends[i] - best_barcode_match.length() + 1; + } else { + barcode_result.found_all_matched_segments = false; + } + } else { + // Discovery Mode (Fallback when no list provided) + const int len = segment_read_end - segment_read_start; + if (len > 0 && segment_read_start + len <= (int)seq.length()) { + barcode_result.features[s.name] = seq.substr(segment_read_start, len); + refined_segment_starts[i] = segment_read_start; + refined_segment_ends[i] = segment_read_end - 1; + } else { + barcode_result.features[s.name] = ""; + refined_segment_starts[i] = segment_read_start; + refined_segment_ends[i] = segment_read_start - 1; + } + } } +} - //if not checking against known list of barcodes, return sequence after the primer - //also check for a perfect match straight up as this will save computer later. - // - // read_to_subpatterns[subpattern_index] gives start of subpattern in the read - std::string exact_bc = seq.substr( - read_to_subpatterns[bc_index], - search_pattern[bc_index].second.length()); - if (known_barcodes->size()==0 || (known_barcodes->find(exact_bc) != known_barcodes->end())){ - barcode.barcode=exact_bc; - barcode.editd=0; - barcode.unambiguous=true; - barcode.umi = get_umi(seq, search_pattern, read_to_subpatterns, umi_index, bc_index, false, 0, 0); - return(barcode); - } +// Helper: Process MATCHED_SPLIT segments (Pass 2) +void refine_split_segments(const string &seq, + const std::vector &segments, + const std::unordered_map> *known_barcodes_map, + const std::unordered_map *group_map, + const std::vector &read_to_segment_starts, + Barcode &barcode_result, + std::vector &refined_segment_starts, + std::vector &refined_segment_ends) { + + for (size_t i = 0; i < segments.size(); ++i) { + if (segments[i].type != MATCHED_SPLIT) continue; + if (refined_segment_starts[i] != -1) continue; // Already processed as part of a group + + const std::string group_name = segments[i].bc_list_name; + if (group_map->find(group_name) == group_map->end()) { + cerr << "Error: Undefined group " << group_name << ".\n"; exit(1); + } - // otherwise widen our search space and the look for matches with errors + const BarcodeGroup& bg = group_map->at(group_name); + const std::vector& split_group_indices = bg.segment_indices; + + std::vector part_seqs; + std::vector part_starts; + part_seqs.reserve(split_group_indices.size()); + part_starts.reserve(split_group_indices.size()); + bool possible_to_extract = true; + + for (size_t idx : split_group_indices) { + const Segment& s = segments[idx]; + const int segment_read_start = read_to_segment_starts[idx]; + const int segment_read_end = + (idx + 1 < read_to_segment_starts.size()) + ? read_to_segment_starts[idx + 1] + : barcode_result.flank_end; + + const int search_start = max(0, segment_read_start - s.buffer_size); + const int search_end = min((int)seq.length(), segment_read_end + s.buffer_size); + + if (search_end <= search_start) { + possible_to_extract = false; + break; + } - int left_bound = max( - read_to_subpatterns[bc_index] - OFFSET, // widen the search by using an OFFSET - 0 // set a maximum starting character index of 0 - ); - int max_length = search_pattern[bc_index].second.length() + 2 * OFFSET; + part_seqs.push_back(seq.substr(search_start, search_end - search_start)); + part_starts.push_back(search_start); + } - std::string barcode_seq = seq.substr(left_bound, max_length); + if (!possible_to_extract) { + barcode_result.found_all_matched_segments = false; + continue; + } - //iterate over all the known barcodes, checking each sequentially - unordered_set::iterator known_barcodes_itr=known_barcodes->begin(); - unsigned int editDistance, endDistance; + // Lookup group barcode list. If not present or empty, fall back to discovery mode. + const unordered_set* current_bclist = nullptr; + auto it = known_barcodes_map->find(group_name); + if (it != known_barcodes_map->end()) current_bclist = &(it->second); + + if (current_bclist && !current_bclist->empty()) { + unsigned int best_edit_distance = 100; + std::string best_barcode_match = ""; + std::vector best_part_starts_in_read(split_group_indices.size(), 0); + unsigned int best_total_wiggle_offset = std::numeric_limits::max(); // Initialize with a large value + bool current_group_unambiguous = false; + + std::vector known_split_offsets; + known_split_offsets.reserve(split_group_indices.size()); + size_t running_offset = 0; + for (size_t idx : split_group_indices) { + known_split_offsets.push_back(running_offset); + running_offset += segments[idx].pattern.length(); + } + + for (const auto& known_bc : *current_bclist) { + unsigned int total_edit_distance = 0; + std::vector current_part_starts; + current_part_starts.reserve(split_group_indices.size()); + bool possible_match = true; + + for (size_t k = 0; k < split_group_indices.size(); ++k) { + const size_t idx = split_group_indices[k]; + const int offset = known_split_offsets[k]; + int len = segments[idx].pattern.length(); + + if (offset + len > (int)known_bc.length()) len = (int)known_bc.length() - offset; + if (len <= 0) { + possible_match = false; + break; + } + + const std::string known_part = known_bc.substr(offset, len); + unsigned int endDist = 0; + const unsigned int part_ed = + edit_distance(part_seqs[k], known_part, endDist, + segments[idx].max_edit_distance); + + if (part_ed > (unsigned)segments[idx].max_edit_distance) { + possible_match = false; + break; + } + total_edit_distance += part_ed; + current_part_starts.push_back(part_starts[k] + endDist - known_part.length()); + } - for(; known_barcodes_itr != known_barcodes->end(); known_barcodes_itr++){ - search_string = *known_barcodes_itr; //known barcode to check against - editDistance = edit_distance(barcode_seq, search_string, endDistance, barcode_max_editd); + if (!possible_match) + continue; - if (editDistance == barcode.editd) { - barcode.unambiguous = false; - } else if (editDistance < barcode.editd && editDistance <= barcode_max_editd) { // if best so far, update - barcode.unambiguous = true; - barcode.editd = editDistance; - barcode.barcode = *known_barcodes_itr; - barcode.umi = get_umi(seq, search_pattern, read_to_subpatterns, umi_index, bc_index, true, left_bound, endDistance); + // Calculate current_total_wiggle_offset for the grouped barcode + unsigned int current_total_wiggle_offset = 0; + for (size_t k = 0; k < split_group_indices.size(); ++k) { + const size_t idx = split_group_indices[k]; + current_total_wiggle_offset += std::abs(current_part_starts[k] - read_to_segment_starts[idx]); + } - //if perfect match is found we're done. - if (editDistance == 0) { - return(barcode); + if (total_edit_distance < best_edit_distance) { + current_group_unambiguous = true; + best_edit_distance = total_edit_distance; + best_barcode_match = known_bc; + best_part_starts_in_read = current_part_starts; + best_total_wiggle_offset = current_total_wiggle_offset; + } else if (total_edit_distance == best_edit_distance) { + if (current_total_wiggle_offset < best_total_wiggle_offset) { + current_group_unambiguous = true; + best_edit_distance = total_edit_distance; + best_barcode_match = known_bc; + best_part_starts_in_read = current_part_starts; + best_total_wiggle_offset = current_total_wiggle_offset; + } else if (current_total_wiggle_offset == best_total_wiggle_offset) { + current_group_unambiguous = false; + } + } + } + + if (best_edit_distance <= (unsigned)bg.max_edit_distance && current_group_unambiguous) { + size_t running_offset = 0; + for (size_t k = 0; k < split_group_indices.size(); ++k) { + const size_t idx = split_group_indices[k]; + int len = segments[idx].pattern.length(); + if (running_offset + len > best_barcode_match.length()) + len = best_barcode_match.length() - running_offset; + + barcode_result.features[segments[idx].name] = + best_barcode_match.substr(running_offset, len); + refined_segment_starts[idx] = best_part_starts_in_read[k]; + refined_segment_ends[idx] = best_part_starts_in_read[k] + len - 1; + running_offset += segments[idx].pattern.length(); + } + barcode_result.features[group_name] = best_barcode_match; + } else { + barcode_result.found_all_matched_segments = false; } - } + } else { + // Discovery mode for MATCHED_SPLIT: + // No known list for the group, so extract each part based on the approximate + // alignment-derived boundaries and concatenate to a group-level feature. + std::string group_concat; + group_concat.reserve(256); + + for (size_t k = 0; k < split_group_indices.size(); ++k) { + const size_t idx = split_group_indices[k]; + const Segment& s = segments[idx]; + + int segment_read_start = read_to_segment_starts[idx]; + int segment_read_end = + (idx + 1 < read_to_segment_starts.size()) + ? read_to_segment_starts[idx + 1] + : barcode_result.flank_end; + + int extract_start = max(0, segment_read_start); + int extract_end = min((int)seq.length(), segment_read_end); + + // Anchor left boundary to previous refined split-part if we have it. + if (k > 0) { + const size_t prev_idx = split_group_indices[k - 1]; + if (refined_segment_ends[prev_idx] != -1) { + extract_start = max(extract_start, refined_segment_ends[prev_idx] + 1); + } + } + // Anchor right boundary to next refined split-part if we have it. + if (k + 1 < split_group_indices.size()) { + const size_t next_idx = split_group_indices[k + 1]; + if (refined_segment_starts[next_idx] != -1) { + extract_end = min(extract_end, refined_segment_starts[next_idx]); + } + } + + // If still unresolved, fall back to expected pattern length, starting at the approximate position. + if (extract_end <= extract_start) { + extract_start = max(0, segment_read_start); + extract_end = min((int)seq.length(), extract_start + (int)s.pattern.length()); + } + + if (extract_end < extract_start) extract_end = extract_start; + + const std::string part = seq.substr(extract_start, extract_end - extract_start); + barcode_result.features[s.name] = part; + refined_segment_starts[idx] = extract_start; + refined_segment_ends[idx] = extract_start + (int)part.length() - 1; + + group_concat += part; + } + + barcode_result.features[group_name] = group_concat; + } } - return(barcode); //return the best matched barcode and associated information } -//search a read for one or more barcodes (parent function that calls get_barcode) -vector big_barcode_search(string & sequence, unordered_set & known_barcodes, int max_flank_editd, int max_editd, const std::vector> &search_pattern) { - - vector return_vec; //vector of all the barcodes found - - //search for barcode - Barcode result=get_barcode(sequence,&known_barcodes,max_flank_editd,max_editd, search_pattern); //,ss); - if(result.editd<=max_editd && result.unambiguous) //add to return vector if edit distance small enough - return_vec.push_back(result); - - //if a result was found, mask out the flanking sequence and search again in case there are more. - if(return_vec.size()>0){ - string masked_sequence = sequence; - for(int i=0; i masked_res; - masked_res=big_barcode_search(masked_sequence,known_barcodes,max_flank_editd,max_editd, search_pattern); //,ss); - return_vec.insert(return_vec.end(),masked_res.begin(),masked_res.end()); //add to result +// Helper: Process RANDOM segments (Pass 3) +void extract_random_segments(const string &seq, + const std::vector &segments, + const std::vector &read_to_segment_starts, + const std::vector &refined_segment_starts, + const std::vector &refined_segment_ends, + Barcode &barcode_result) { + + for (size_t i = 0; i < segments.size(); ++i) { + const Segment &s = segments[i]; + if (s.type == MATCHED || s.type == MATCHED_SPLIT) continue; + + int extract_start = read_to_segment_starts[i]; + int extract_end = (i + 1 < read_to_segment_starts.size()) + ? read_to_segment_starts[i + 1] + : barcode_result.flank_end; + + if (s.type == RANDOM) { + // Anchor to previous matched segment if available + if (i > 0 && + (segments[i - 1].type == MATCHED || segments[i - 1].type == MATCHED_SPLIT) && + refined_segment_ends[i - 1] != -1) { + extract_start = refined_segment_ends[i - 1] + 1; + extract_end = extract_start + (int)s.pattern.length(); + } + // Anchor to next matched segment if available + else if (i + 1 < segments.size() && + (segments[i + 1].type == MATCHED || segments[i + 1].type == MATCHED_SPLIT) && + refined_segment_starts[i + 1] != -1) { + extract_end = refined_segment_starts[i + 1]; + extract_start = extract_end - (int)s.pattern.length(); + } + + int actual_extract_start = max(0, extract_start); + int actual_extract_end = min((int)seq.length(), extract_end); + + if (actual_extract_end < actual_extract_start) actual_extract_end = actual_extract_start; + + barcode_result.features[s.name] = + seq.substr(actual_extract_start, actual_extract_end - actual_extract_start); + } } - return(return_vec); +} + +vector big_barcode_search( + const string &sequence, + const std::unordered_map> *known_barcodes_map, + const std::unordered_map *group_map, + int global_flank_max_editd, + int global_barcode_edit_distance, + const std::vector &segments) { + vector return_vec; + string masked_sequence = sequence; // Work on a copy + + while (true) { + Barcode result = extract_features(masked_sequence, segments, known_barcodes_map, + group_map, global_flank_max_editd, + global_barcode_edit_distance); + + if (result.flank_editd <= global_flank_max_editd && result.found_all_matched_segments) { + return_vec.push_back(result); + + // Mask the found region to prevent re-finding it + // result.flank_end is inclusive, so length is end - start + 1 + const int match_length = result.flank_end - result.flank_start + 1; + + if (match_length > 0) { + masked_sequence.replace(result.flank_start, match_length, string(match_length, 'X')); + } else { + break; // Should not happen for valid match, but prevents infinite loop + } + } else { + break; + } + } + return return_vec; } + // utility function to check true/false input options bool get_bool_opt_arg(string value){ transform(value.begin(), value.end(), value.begin(), ::tolower); @@ -478,153 +867,227 @@ bool get_bool_opt_arg(string value){ } // print information about barcodes -void print_stats(string read_id, vector & vec_bc, ostream & out_stream){ +void print_stats(const string& read_id, const vector & vec_bc, ostream & out_stream, const std::vector &segments){ for(int b=0; bsecond; + } else { + out_stream << "\t"; + } + } + } + out_stream << "\t" << vec_bc.at(b).flank_editd << "\n"; } } -void print_line(string id, string read, string quals, bool is_fastq, ostream & out_stream){ +void print_line(const string& id, const string& read, const string& quals, ostream & out_stream){ + + //flag for read format + bool is_fastq=!(quals==""); //no quality scores passed = fasta //output to the new read file if(is_fastq) - out_stream << "@" << id << "\n"; + out_stream << "@" << id << endl; else - out_stream << ">" << id << "\n"; + out_stream << ">" << id << endl; out_stream << read << "\n"; if(is_fastq){ - out_stream << "+" << id << "\n"; + out_stream << "+" << id << endl; out_stream << quals << "\n"; } } -//print fastq or fasta lines.. -void print_read(string read_id, string read, string qual, - vector & vec_bc, string prefix, - bool split, unordered_set & found_barcodes, - bool trim_barcodes, - bool chimeric, bool is_fastq){ - - auto vec_size = vec_bc.size(); - - //loop over the barcodes found... usually will just be one - for (int b = 0; b < vec_size; b++) { - - // format the new read id. Using FLAMES format. - stringstream ss; - ss << (b + 1) << "of" << vec_size; - if (chimeric) { - ss << "_" << "C"; - } +std::string compose_new_id( + const std::string &read_id, const Barcode &bc, int which, int total, + bool chimeric, const std::vector &segments, + const std::unordered_map &group_map, + std::string &primary_barcode) { + + std::ostringstream ss_suffix; + ss_suffix << which << "of" << total; + if (chimeric) + ss_suffix << "_C"; + + std::ostringstream prefix; + + // print the grouped barcodes as a whole first + for (const auto &g : group_map) { + auto it = bc.features.find(g.first); + if (it != bc.features.end()) { + prefix << it->second << "_"; + if (primary_barcode.empty()) + primary_barcode = it->second; + } else { + prefix << "NA_"; + } + } - string barcode = vec_bc.at(b).barcode; - // also add the proper FASTQ way: \tCB:Z:barcode\tUB:Z:umi - string new_read_id = - barcode + "_" + vec_bc.at(b).umi + "#" + read_id + ss.str() + "\tCB:Z:" + barcode + "\tUB:Z:" + vec_bc[b].umi; + for (const auto &s : segments) { + if (s.type == FIXED) + continue; + auto it = bc.features.find(s.name); + if (it != bc.features.end()) { + prefix << it->second << "_"; + if (s.type == MATCHED && primary_barcode.empty()) + primary_barcode = it->second; + } else { + prefix << "NA_"; + } + } - // work out the start and end base in case multiple barcodes - // note: read_start+1, see issue #63 - int read_start = vec_bc.at(b).flank_end + 1; - int read_length = read.length() - read_start; + std::string id_prefix = prefix.str(); + if (!id_prefix.empty() && id_prefix.back() == '_') + id_prefix.pop_back(); + + // Add CB tag (assume always present) + std::string new_id = id_prefix + "#" + read_id + ss_suffix.str() + "\t" + "CB:Z:"; + std::string delim = ""; + for (const auto &g : group_map) { + auto it = bc.features.find(g.first); + if (it != bc.features.end()) { + new_id += delim + g.first + ":" + it->second; + delim = ","; + } + } + for (const auto &s : segments) { + if (s.type != MATCHED) + continue; + auto it = bc.features.find(s.name); + if (it != bc.features.end()) { + new_id += delim + s.name + (s.name == "" ? "" : ":") + it->second; + delim = ","; + } + } - for (int f = 0; f < vec_size; f++) { - int temp_read_length = vec_bc.at(f).flank_start - read_start; - if (temp_read_length >= 0 && temp_read_length < read_length) - read_length = temp_read_length; - } - string qual_new = ""; // don't trim the quality scores if it's a fasta file + // Add UB tag (if present, concatonate all UB segments if multiple present) + std::string ub; + for (const auto &s : segments) { + if (s.type != RANDOM) + continue; + auto it = bc.features.find(s.name); + if (it != bc.features.end()) { + ub += it->second; + } + } + if (!ub.empty()) { + new_id += "\tUB:Z:" + ub; + } - if (qual != "") { - if((read_start+read_length)>(qual.length())) { - cerr << "WARNING: sequence and quality lengths diff for read: " << read_id << ". Ignoring read." << endl; - return; - } - qual_new = qual.substr(read_start, read_length); - } - string read_new = read.substr(read_start, read_length); + return new_id; +} - if (b == 0 && !trim_barcodes) { // override if read shouldn't be cut - new_read_id = read_id; - read_new = read; - qual_new = qual; - b = vec_size; // force loop to exit after this iteration - } +//print fastq or fasta lines.. +void print_read(const string& read_id, const string& read, + const string qual, + const vector & vec_bc, const string& prefix, + bool split, map & barcode_file_streams, + mutex & cout_mutex, mutex & file_mutex, + bool trim_barcodes, + bool chimeric, + const std::vector &segments, + const std::unordered_map &group_map){ + + const size_t vec_size = vec_bc.size(); + + for (int b = 0; b < vec_size; b++) { + const Barcode &bc = vec_bc.at(b); + + if (bc.flank_end < 0) { + continue; + } - // Skip reads that become empty after trimming - if (read_new.length() == 0) { - continue; + string primary_barcode_for_filename; + string new_read_id = + compose_new_id(read_id, bc, b + 1, vec_size, chimeric, segments, group_map, primary_barcode_for_filename); + + int read_start = bc.flank_end + 1; + // work out the start and end base in case multiple barcodes + int next_barcode_start = read.length(); + for (int k = 0; k < vec_size; k++) { + if (b == k) continue; + if (vec_bc.at(k).flank_start >= read_start) { + next_barcode_start = std::min(next_barcode_start, vec_bc.at(k).flank_start); } - - if (split) { // to a file if splitting by barcode - string outname = prefix + "_" + barcode + "."; - if (qual == "") - outname += "fasta"; - else - outname += "fastq"; - ofstream outstream; - if (found_barcodes.insert(barcode).second) - outstream.open(outname); // override file if this is the first read - // for the barcode - else - outstream.open(outname, ofstream::app); // remove file if this is the - // first read for the barcode - print_line(new_read_id, read_new, qual_new, is_fastq, outstream); - outstream.close(); - } else { - print_line(new_read_id, read_new, qual_new, is_fastq, std::cout); + } + int read_length = next_barcode_start - read_start; + read_length = std::max(0, read_length); + + string qual_new; + if (!qual.empty()) { + if (read_start + read_length > (int)qual.length()){ + lock_guard lock(cout_mutex); + cerr << "WARNING: sequence and quality lengths diff for read: " << read_id << ". Ignoring read." << endl; + return; } + qual_new = qual.substr(read_start, read_length); + } + string read_new = read.substr(read_start, read_length); + + if (b == 0 && !trim_barcodes) { + new_read_id = read_id; + read_new = read; + qual_new = qual; + } + + if (read_new.empty()) { + continue; } -} -// separated out from main so that this can be run with threads -void search_read(vector & reads, unordered_set & known_barcodes, - int flank_edit_distance, int edit_distance, - const std::vector> &search_pattern) { - - for (int r=0; r lock(file_mutex); + string barcode_for_split = primary_barcode_for_filename.empty() ? "UNKNOWN" : primary_barcode_for_filename; + if (barcode_file_streams.find(barcode_for_split) == barcode_file_streams.end()) { + string outname = prefix + "_" + barcode_for_split + (qual.empty() ? ".fasta" : ".fastq"); + barcode_file_streams[barcode_for_split].open(outname); + } + print_line(new_read_id, read_new, qual_new, barcode_file_streams[barcode_for_split]); + } else { + lock_guard lock(cout_mutex); + print_line(new_read_id, read_new, qual_new, std::cout); + } } } + + // check if file already exists bool file_exists(const std::string &filename) { std::ifstream infile(filename); return infile.good(); } +// Helper function to parse sub-options +void parse_sub_options(const string& opt_string, string& primary, map& options) { + size_t comma_pos = opt_string.find(','); + if (comma_pos == string::npos) { + primary = opt_string; + return; + } + primary = opt_string.substr(0, comma_pos); + + size_t start = comma_pos + 1; + while (start < opt_string.length()) { + comma_pos = opt_string.find(',', start); + string kv_pair; + if (comma_pos == string::npos) { + kv_pair = opt_string.substr(start); + start = opt_string.length(); + } else { + kv_pair = opt_string.substr(start, comma_pos - start); + start = comma_pos + 1; + } + + size_t colon_pos = kv_pair.find(':'); + if (colon_pos != string::npos) { + options[kv_pair.substr(0, colon_pos)] = kv_pair.substr(colon_pos + 1); + } + } +} + // MAIN is here!! int main(int argc, char **argv) { std::ios_base::sync_with_stdio(false); @@ -633,7 +1096,6 @@ int main(int argc, char **argv) { // Variables to store user options // Set these to their defaults - int expected_cells = 0; //(d) int edit_distance = 2; //(e) int flank_edit_distance = 8; //(f) @@ -643,31 +1105,39 @@ int main(int argc, char **argv) { string out_filename_prefix = "flexiplex"; //(n) bool split_file_by_barcode = false; //(s) - bool remove_barcodes = true; //(r) + bool remove_barcodes = true; //(i) bool print_chimeric = false; //(c) - std::vector> search_pattern; + std::vector search_pattern; + + // Set of known barcodes (can be multiple, identified by name) + std::unordered_map> known_barcodes_map; + // Flag to track if any -b segment specified its own barcode list - // Set of known barcodes - unordered_set known_barcodes; - unordered_set found_barcodes; + // Map to store group settings + std::unordered_map group_map; + + // Counters for automatic naming + int barcode_count = 0; + int umi_count = 0; // threads int n_threads = 1; - /*** Pass command line option *****/ + /*** Pass command line option *****/\ int c; int params = 1; ifstream file; string line; vector myArgs(argv, argv + argc); + vector allocated_args; + while ((c = getopt(myArgs.size(), myArgs.data(), - "d:k:i:b:u:x:e:f:n:s:hp:c:")) != EOF) { + "d:k:i:b:u:x:e:f:n:s:hp:c:g:")) != EOF) { switch (c) { - case 'd': { // d=predefined list of settings for various search/barcode - // schemes + case 'd': { // d=predefined list of settings for various search/barcode schemes if (predefinedMap.find(optarg) == predefinedMap.end()) { cerr << "Unknown argument, " << optarg << ", passed to option -d. See list below for options.\n"; @@ -680,41 +1150,46 @@ int main(int argc, char **argv) { vector newArgv; while (settingsStream >> token) { // code created with the help of chatGPT token.erase(remove(token.begin(), token.end(), '\''), token.end()); - char *newArg = - new char[token.size() + - 1]; // +1 for null terminator //need to delete these later. + char *newArg = new char[token.size() + 1]; // +1 for null terminator strcpy(newArg, token.c_str()); newArgv.push_back(newArg); // Append the token to the new argv } params += 2; - myArgs.insert(myArgs.begin() += params, newArgv.begin(), newArgv.end()); + myArgs.insert(myArgs.begin() + params, newArgv.begin(), newArgv.end()); + allocated_args.insert(allocated_args.end(), newArgv.begin(), newArgv.end()); break; } - case 'k': { // k=list of known barcodes + case 'k': { // k=list of known barcodes (global barcode list) + // If -g is used or -B with list is used, -k might be ambiguous or disallowed. + // Allow -k only if NO groups or explicit lists are ever defined to keep it simple. + string file_name(optarg); string bc; + unordered_set global_bclist; /**** READ BARCODE LIST FROM FILE ******/ file.open(file_name); if (!(file.good())) { // if the string given isn't a file cerr << "Reading known barcodes from string: " << file_name << "\n"; stringstream bc_list(file_name); while (getline(bc_list, bc, ',')) // tokenize - known_barcodes.insert(bc); + global_bclist.insert(bc); } else { // otherwise get the barcodes from the file.. cerr << "Setting known barcodes from " << file_name << "\n"; while (getline(file, line)) { istringstream line_stream(line); line_stream >> bc; - known_barcodes.insert(bc); + global_bclist.insert(bc); } file.close(); } - cerr << "Number of known barcodes: " << known_barcodes.size() << "\n"; - if (known_barcodes.size() == 0) { + cerr << "Number of known barcodes in global list: " << global_bclist.size() << "\n"; + if (global_bclist.empty()) { print_usage(); exit(1); // case barcode file is empty } + // Move to avoid copying potentially large sets. + known_barcodes_map["global"] = std::move(global_bclist); params += 2; break; } @@ -726,7 +1201,7 @@ int main(int argc, char **argv) { } case 'e': { edit_distance = atoi(optarg); - cerr << "Setting max barcode edit distance to " << edit_distance << "\n"; + cerr << "Setting max barcode edit distance to " << edit_distance << " (global default).\n"; params += 2; break; } @@ -737,25 +1212,173 @@ int main(int argc, char **argv) { params += 2; break; } - // x, u, b arguments inserts subpatterns to search_pattern - case 'x': { - search_pattern.push_back(std::make_pair("Unnamed Seq", optarg)); - cerr << "Adding flank sequence to search for: " << optarg << "\n"; + case 'x': { // Fixed segment + Segment s; + s.type = FIXED; + s.pattern = optarg; + s.name = "Fixed_" + to_string(search_pattern.size()); + search_pattern.push_back(s); + cerr << "Adding fixed sequence to search for: " << optarg << "\n"; params += 2; break; } - case 'u': { - search_pattern.push_back(std::make_pair("UMI", optarg)); - cerr << "Setting UMI to search for: " << optarg << "\n"; + case 'u': { // Random (UMI) segment + Segment s; + s.type = RANDOM; + s.name = ""; + s.buffer_size = 0; + + map options; + parse_sub_options(optarg, s.pattern, options); + cerr << "Setting UMI to search for: " << s.pattern; + + if (options.count("name")) { + s.name = options["name"]; + cerr << " (name: " << s.name << ")"; + } + if (options.count("buffer")) { + s.buffer_size = stoi(options["buffer"]); + cerr << " (buffer: " << s.buffer_size << ")"; + } + + if (s.name.empty()) { + umi_count++; + s.name = (umi_count == 1) ? "UB" : "UB" + to_string(umi_count); + } else { + umi_count++; + } + + search_pattern.push_back(s); + cerr << " -> named: " << s.name << "\n"; params += 2; break; } case 'b': { - search_pattern.push_back(std::make_pair("BC", optarg)); - cerr << "Setting barcode to search for: " << optarg << "\n"; + Segment s; + s.type = MATCHED; + s.name = ""; + s.buffer_size = 5; + s.max_edit_distance = edit_distance; + s.bc_list_name = "global"; + + string group_name = ""; + map options; + parse_sub_options(optarg, s.pattern, options); + + cerr << "Adding barcode segment: " << s.pattern; + + if (options.count("name")) { + s.name = options["name"]; + cerr << " (name: " << s.name << ")"; + } + if (options.count("buffer")) { + s.buffer_size = stoi(options["buffer"]); + cerr << " (buffer: " << s.buffer_size << ")"; + } + if (options.count("max_ed")) { + s.max_edit_distance = stoi(options["max_ed"]); + cerr << " (max_ed: " << s.max_edit_distance << ")"; + } + if (options.count("group")) { + group_name = options["group"]; + cerr << " (group: " << group_name << ")"; + } + if (options.count("list")) { + string file_name = options["list"]; + // Loading list logic + if (known_barcodes_map.find(file_name) == known_barcodes_map.end()) { + unordered_set bclist; + ifstream bc_file(file_name); + if (bc_file.good()) { + string bc_line, bc; + while (getline(bc_file, bc_line)) { + istringstream line_stream(bc_line); + line_stream >> bc; + bclist.insert(bc); + } + known_barcodes_map[file_name] = std::move(bclist); + cerr << " (loaded " << known_barcodes_map[file_name].size() << " barcodes from " << file_name << ")"; + } else { + cerr << "\nError: Could not open barcode list file: " << file_name << "\n"; + exit(1); + } + } else { + cerr << " (using loaded list " << file_name << ")"; + } + s.bc_list_name = file_name; + } + + if (s.name.empty()) { + barcode_count++; + s.name = (barcode_count == 1) ? "" : "BC" + to_string(barcode_count); + } else { + barcode_count++; + } + + if (!group_name.empty()) { + if (options.count("list")) { + cerr << "\nError: Please specify the list file in the corresponding -g group definition if the segment is part of a group.\n"; + exit(1); + } + s.bc_list_name = group_name; + s.type = MATCHED_SPLIT; + } + + search_pattern.push_back(s); + cerr << " -> named: " << s.name << "\n"; params += 2; break; } + case 'g': { // Define a group + BarcodeGroup bg; + bg.max_edit_distance = 2; + + string group_name_dummy; + map options; + parse_sub_options(optarg, bg.name, options); // The primary value is the group name + + cerr << "Defining group: " << bg.name; + + if (options.count("list")) { + string list_file = options["list"]; + cerr << " (list: " << list_file << ")"; + + // Re-using logic to load list, but here we store it under bg.name + if (known_barcodes_map.find(bg.name) != known_barcodes_map.end()) { + cerr << "\nError: Group name " << bg.name << " already defined or used.\n"; + exit(1); + } + + unordered_set bclist; + ifstream bc_file(list_file); + if (bc_file.good()) { + string bc_line, bc; + while (getline(bc_file, bc_line)) { + istringstream line_stream(bc_line); + line_stream >> bc; + bclist.insert(bc); + } + known_barcodes_map[bg.name] = std::move(bclist); + cerr << " (loaded " << known_barcodes_map[bg.name].size() << " barcodes)"; + } else { + cerr << "\nError: Could not open barcode list file: " << list_file << "\n"; + exit(1); + } + } else { + cerr << "\nError: Group definition must include 'list:filename'.\n"; + exit(1); + } + + if (options.count("max_ed")) { + bg.max_edit_distance = stoi(options["max_ed"]); + cerr << " (max_ed: " << bg.max_edit_distance << ")"; + } + + group_map[bg.name] = bg; + cerr << "\n"; + params += 2; + break; + } case 'h': { print_usage(); exit(0); @@ -771,18 +1394,12 @@ int main(int argc, char **argv) { split_file_by_barcode = get_bool_opt_arg(optarg); cerr << "Split read output into separate files by barcode: " << split_file_by_barcode << "\n"; - int max_split_bc = 50; - if (known_barcodes.size() > max_split_bc) { - cerr << "Too many barcodes to split into separate files: " - << known_barcodes.size() << "> " << max_split_bc << "\n"; - split_file_by_barcode = false; - } + params += 2; break; } case 'c': { print_chimeric = get_bool_opt_arg(optarg); - params += 2; break; } @@ -799,15 +1416,83 @@ int main(int argc, char **argv) { } } - // default case when no x, u, b is speficied + // free memory from -d option + for (auto arg : allocated_args) { + delete[] arg; + } + + // Validation and sanity checks + bool uses_global_list = false; + bool uses_explicit_list = false; + + if (known_barcodes_map.find("global") != known_barcodes_map.end()) { + uses_global_list = true; + } + + // Check what search patterns rely on + for (const auto& s : search_pattern) { + if (s.type == MATCHED || s.type == MATCHED_SPLIT) { + if (s.bc_list_name == "global") { + if (!uses_global_list) { + // This segment needs global list but it's not provided + // TODO: What to do with multiple -b segments and descovery mode? + } + } else { + uses_explicit_list = true; + } + } + } + + if (uses_global_list && uses_explicit_list) { + cerr << "Error: You cannot use -k (global list) when -b or -g specifies explicit barcode lists.\n"; + print_usage(); + exit(1); + } + + // Populate group segment indices + for (size_t i = 0; i < search_pattern.size(); ++i) { + if (search_pattern[i].type == MATCHED_SPLIT) { + string grp_name = search_pattern[i].bc_list_name; + if (group_map.find(grp_name) != group_map.end()) { + group_map[grp_name].segment_indices.push_back(i); + } else { + cerr << "Error: Barcode segment " << search_pattern[i].name << " refers to undefined group '" << grp_name << "'.\n"; + exit(1); + } + } + } + + // default case when no x, u, b, B is speficied if (search_pattern.empty()) { cerr << "Using default search pattern: " << endl; - search_pattern = {{"primer", "CTACACGACGCTCTTCCGATCT"}, - {"BC", std::string(16, '?')}, - {"UMI", std::string(12, '?')}, - {"polyA", std::string(9, 'T')}}; - for (auto i : search_pattern) - std::cerr << i.first << ": " << i.second << "\n"; + Segment s_primer, s_bc, s_umi, s_polya; + + s_primer.type = FIXED; + s_primer.pattern = "CTACACGACGCTCTTCCGATCT"; + s_primer.name = "primer"; + search_pattern.push_back(s_primer); + + s_bc.type = MATCHED; + s_bc.pattern = std::string(16, '?'); + s_bc.name = "CB"; + s_bc.buffer_size = 5; + s_bc.max_edit_distance = edit_distance; + s_bc.bc_list_name = "global"; + search_pattern.push_back(s_bc); + + s_umi.type = RANDOM; + s_umi.pattern = std::string(12, '?'); + s_umi.name = "UB"; + s_umi.buffer_size = 0; + search_pattern.push_back(s_umi); + + s_polya.type = FIXED; + s_polya.pattern = std::string(9, 'T'); + s_polya.name = "polyA"; + search_pattern.push_back(s_polya); + + for (auto const& s : search_pattern) + std::cerr << s.name << ": " << s.pattern << "\n"; } cerr << "For usage information type: flexiplex -h" << endl; @@ -828,26 +1513,32 @@ int main(int argc, char **argv) { print_usage(); exit(1); } + cerr << "Reading reads from file " << reads_file << endl; in = &reads_ifs; } /********* FIND BARCODE IN READS ********/ - string sequence; - int bc_count = 0; - int r_count = 0; - int multi_bc_count = 0; + atomic r_count(0); + atomic bc_count(0); + atomic multi_bc_count(0); ofstream out_stat_file; out_stat_filename = out_filename_prefix + "_" + out_stat_filename; out_bc_filename = out_filename_prefix + "_" + out_bc_filename; - if (known_barcodes.size() > 0) { + if (!known_barcodes_map.empty()) { if (file_exists(out_stat_filename)) { cerr << "File " << out_stat_filename << " already exists, overwriting." << endl; } out_stat_file.open(out_stat_filename, std::ios::trunc); - out_stat_file << "Read\tCellBarcode\tFlankEditDist\tBarcodeEditDist\tUMI\n"; + out_stat_file << "Read"; + for (const auto& s : search_pattern) { + if (s.type != FIXED) { + out_stat_file << "\t" << (s.name.empty() ? "CB" : s.name); + } + } + out_stat_file << "\tFlankEditDist\n"; } cerr << "Searching for barcodes...\n"; @@ -859,146 +1550,152 @@ int main(int argc, char **argv) { if (getline(*in, read_id_line)) { // check the first line for file type if (read_id_line[0] == '>') { is_fastq = false; - } else if (read_id_line[0] == '@') { // fasta - ignore! - } else { + } else if (read_id_line[0] != '@') { cerr << "Unknown read format... exiting" << endl; exit(1); } + } else { // Empty file + return 0; } - while (getline(*in, line)) { - const int buffer_size = 2000; // number of reads to pass to one thread. + // --- Batch Threading --- + // Read input in fixed-size chunks, distribute chunks to threads, + // join threads, then write results in the same order as input. - vector> sr_v(n_threads); - for (int i = 0; i < n_threads; i++) { - sr_v[i] = vector(buffer_size); - } + const int buffer_size = 2000; // reads per thread batch - vector threads(n_threads); + // Mutexes for synchronized output (only needed for split files) + mutex cout_mutex; + mutex file_mutex; + map barcode_file_streams; - // get n_threads*buffer number of reads.. - for (int t = 0; t < n_threads; t++) { - for (int b = 0; b < buffer_size; b++) { - SearchResult &sr = sr_v[t][b]; + while (*in) { + std::vector> sr_v(n_threads); + for (int t = 0; t < n_threads; ++t) { + sr_v[t] = std::vector(); + sr_v[t].reserve(buffer_size); + } - sr.line = line; - string read_id; + // Fill per-thread batches in order + bool any_reads = false; + for (int t = 0; t < n_threads; ++t) { + for (int b = 0; b < buffer_size; ++b) { + if (!*in) break; + if (read_id_line.empty()) break; + if (read_id_line[0] != '@' && read_id_line[0] != '>') { + // tolerate trailing blank lines + break; + } + SearchResult sr; istringstream line_stream(read_id_line); - line_stream >> sr.read_id; - sr.read_id.erase(0, 1); + line_stream >> sr.read_id; + if (!sr.read_id.empty()) sr.read_id.erase(0, 1); if (!is_fastq) { // fasta (account for multi-lines per read) string buffer_string; - while (getline(*in, buffer_string) && buffer_string[0] != '>') + while (getline(*in, buffer_string) && !buffer_string.empty() && buffer_string[0] != '>') { sr.line += buffer_string; + } read_id_line = buffer_string; - } else { // fastq (get quality scores) - for (int s = 0; s < 2; s++) { - getline(*in, sr.qual_scores); + } else { // fastq + if (!getline(*in, sr.line)) { + read_id_line.clear(); + break; } + getline(*in, line); // skip '+' line + getline(*in, sr.qual_scores); getline(*in, read_id_line); } - r_count++; // progress counter - if (// display for every 10,000 reads first - (r_count < 100000 && r_count % 10000 == 0) || - // and then every 100,000 reads after - (r_count % 100000 == 0)) { - cerr << r_count / ((double)1000000) << " million reads processed.." - << endl; - } - - // this is quite ugly, must be a better way to do this.. - if (b == buffer_size - 1 && t == n_threads - 1) { - break; // if it's the last in the chunk don't getline as this happens - // in the while statement - } else if (!getline(*in, line)) { // case we are at the end of the - // reads. - sr_v[t].resize(b + 1); - threads[t] = std::thread(search_read, ref(sr_v[t]), - ref(known_barcodes), flank_edit_distance, - edit_distance, ref(search_pattern)); - for (int t2 = t + 1; t2 < n_threads; t2++) { - sr_v[t2].resize(0); - } + sr_v[t].push_back(std::move(sr)); + any_reads = true; + } - goto print_result; // advance the line - } + // Stop allocating further thread batches if input exhausted + if (!*in || read_id_line.empty()) { + for (int t2 = t + 1; t2 < n_threads; ++t2) sr_v[t2].clear(); + break; } - // send reads to the thread - threads[t] = - std::thread(search_read, ref(sr_v[t]), ref(known_barcodes), - flank_edit_distance, edit_distance, ref(search_pattern)); } - print_result: - // START print_result LABEL... + if (!any_reads) break; - // loop over the threads and print out ther results - for (int t = 0; t < sr_v.size(); t++) { - if (sr_v[t].size() > 0) - threads[t].join(); // wait for the threads to finish before printing + // Launch threads to process each batch + std::vector threads; + threads.reserve(n_threads); + for (int t = 0; t < n_threads; ++t) { + if (sr_v[t].empty()) continue; + threads.emplace_back(search_read_batch, ref(sr_v[t]), ref(known_barcodes_map), ref(group_map), + flank_edit_distance, edit_distance, ref(search_pattern)); + } + + // Join all threads + for (auto &th : threads) th.join(); + + // Write results in deterministic order: t then r (matches fill order above) + for (int t = 0; t < (int)sr_v.size(); ++t) { + for (int r = 0; r < (int)sr_v[t].size(); ++r) { + SearchResult &sr = sr_v[t][r]; + + r_count++; + if (sr.count > 0) bc_count++; + if (sr.chimeric) multi_bc_count++; + + // Count barcodes from features map (first MATCHED segment) + for (const auto& bc : sr.vec_bc_for) { + for (const auto& s : search_pattern) { + if (s.type == MATCHED) { + auto it = bc.features.find(s.name); + if (it != bc.features.end()) { + barcode_counts[it->second]++; + break; + } + } + } + } + for (const auto& bc : sr.vec_bc_rev) { + for (const auto& s : search_pattern) { + if (s.type == MATCHED) { + auto it = bc.features.find(s.name); + if (it != bc.features.end()) { + barcode_counts[it->second]++; + break; + } + } + } + } - for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads + if (!known_barcodes_map.empty()) { + print_stats(sr.read_id, sr.vec_bc_for, out_stat_file, search_pattern); + print_stats(sr.read_id, sr.vec_bc_rev, out_stat_file, search_pattern); - for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++) - barcode_counts[sr_v[t][r].vec_bc_for.at(b).barcode]++; - for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++) - barcode_counts[sr_v[t][r].vec_bc_rev.at(b).barcode]++; + print_read(sr.read_id + "_+", sr.line, sr.qual_scores, sr.vec_bc_for, out_filename_prefix, + split_file_by_barcode, barcode_file_streams, cout_mutex, file_mutex, + remove_barcodes, print_chimeric && sr.chimeric, search_pattern, group_map); - if (sr_v[t][r].count > 0) - bc_count++; - if (sr_v[t][r].chimeric) { - multi_bc_count++; + if (remove_barcodes || sr.vec_bc_for.empty()) { + string rev_qual = sr.qual_scores; + reverse(rev_qual.begin(), rev_qual.end()); + print_read(sr.read_id + "_-", sr.rev_line, rev_qual, sr.vec_bc_rev, out_filename_prefix, + split_file_by_barcode, barcode_file_streams, cout_mutex, file_mutex, + remove_barcodes, print_chimeric && sr.chimeric, search_pattern, group_map); + } } - if (known_barcodes.size() != - 0) { // if we are just looking for all possible barcodes don't - // output reads etc. - - print_stats(sr_v[t][r].read_id, sr_v[t][r].vec_bc_for, out_stat_file); - print_stats(sr_v[t][r].read_id, sr_v[t][r].vec_bc_rev, out_stat_file); - - print_read( - sr_v[t][r].read_id + "_+", - sr_v[t][r].line, - sr_v[t][r].qual_scores, - sr_v[t][r].vec_bc_for, - out_filename_prefix, - split_file_by_barcode, - found_barcodes, - remove_barcodes, - print_chimeric && sr_v[t][r].chimeric, // include chimeric information if requested - is_fastq - ); - - // case we just want to print read once if multiple bc found. - if (remove_barcodes || sr_v[t][r].vec_bc_for.size() == 0) { - // for a chimeric read, we first need to reverse the quality scores - reverse(sr_v[t][r].qual_scores.begin(), sr_v[t][r].qual_scores.end()); - - print_read( - sr_v[t][r].read_id + "_-", - sr_v[t][r].rev_line, - sr_v[t][r].qual_scores, - sr_v[t][r].vec_bc_rev, - out_filename_prefix, - split_file_by_barcode, - found_barcodes, - remove_barcodes, - print_chimeric && sr_v[t][r].chimeric, // include chimeric information if requested - is_fastq - ); - } + if ((r_count < 100000 && r_count % 10000 == 0) || (r_count % 100000 == 0)) { + cerr << r_count / 1000000.0 << " million reads processed.." << endl; } } } - - // END print_result LABEL } - reads_ifs.close(); + // Close all the split files + for (auto& pair : barcode_file_streams) { + if (pair.second.is_open()) { + pair.second.close(); + } + } // print summary statistics cerr << "Number of reads processed: " << r_count << "\n"; @@ -1008,8 +1705,7 @@ int main(int argc, char **argv) { cerr << "All done!" << endl; cerr << "If you like Flexiplex, please cite us! https://doi.org/10.1093/bioinformatics/btae102" << endl; - if (known_barcodes.size() > 0) { - out_stat_file.close(); + if (known_barcodes_map.size() > 0) { return (0); } @@ -1028,21 +1724,23 @@ int main(int argc, char **argv) { return l.first < r.first; }); - vector hist(bc_vec[0].second); - ofstream out_bc_file; - - out_bc_file.open(out_bc_filename); + if (!bc_vec.empty()) { + vector hist(bc_vec[0].second); + ofstream out_bc_file; - for (auto const &bc_pair : bc_vec) { - out_bc_file << bc_pair.first << "\t" << bc_pair.second << "\n"; - hist[bc_pair.second - 1]++; - } + out_bc_file.open(out_bc_filename); - out_bc_file.close(); + for (auto const &bc_pair : bc_vec) { + out_bc_file << bc_pair.first << "\t" << bc_pair.second << "\n"; + if (bc_pair.second > 0) { + hist[bc_pair.second - 1]++; + } + } + out_bc_file.close(); - cout << "Reads\tBarcodes" - << "\n"; - for (int i = hist.size() - 1; i >= 0; i--) - cout << i + 1 << "\t" << hist[i] << "\n"; + cout << "Reads\tBarcodes" << "\n"; + for (int i = hist.size() - 1; i >= 0; i--) + if(hist[i] > 0) + cout << i + 1 << "\t" << hist[i] << "\n"; + } } -